J Biol Chem 281 - Physiomics

Copy and paste this link to your website, so they can see this document directly without any plugins.



Keywords

water, were, that, with, AQP1, which, oocytes, from, inhibition, binding, AQP1,, permeability, (Fig., this, simulations, simulation, AQP2, different, TEA,, four, revealed, their, swelling, pore, Deen,, mutant, membrane, inhibited, permeation, Chem.

Transcript

Quaternary Ammonium Compounds as Water
Channel Blockers
SPECIFICITY, POTENCY, AND SITE OF ACTION*
Received for publication, December 7, 2005, and in revised form, March 16, 2006 Published, JBC Papers in Press, March 21, 2006, DOI 10.1074/jbc.M513072200
Frank J. M. Detmers‡, Bert L. de Groot§, E. Matthias Müller§, Andrew Hinton¶, Irene B. M. Konings‡, Mozes Sze‡,
Sabine L. Flitsch¶1, Helmut Grubmüller§, and Peter M. T. Deen‡2
From the ‡Department of Physiology, Nijmegen Center for Molecular Life Sciences, Radboud University Nijmegen Medical Center,
6500 HB Nijmegen, Nijmegen, The Netherlands, the §Max-Planck Institute for Biophysical Chemistry, Theoretical and
Computational Biophysics Department, Am Fassberg, D-37077, Göttingen, Germany, and the ¶Department of Chemistry,
University of Edinburgh, Kings Buildings, West Mains Road, EH9 3JJ Scotland, United Kingdom
Excessive water uptake through Aquaporins (AQP) can be lifethreatening and reversible AQP inhibitors are needed. Here, we
determined the specificity, potency, and binding site of tetraethylammonium (TEA) to block Aquaporin water permeability. Using
oocytes, externally applied TEA blocked AQP1/AQP2/AQP4 with
IC50 values of 1.4, 6.2, and 9.8M, respectively. Related tetraammonium compounds yielded some (propyl) or no (methyl, butyl, or
pentyl) inhibition. TEA inhibitionwas lost upon a Tyr to Phe amino
acid switch in the external water pore of AQP1/AQP2/AQP4,
whereas the water permeability of AQP3 and AQP5, which lack a
correspondingTyr, was not blocked byTEA.Consistentwith experimental data, multi-nanosecond molecular dynamics simulations
showed one stable binding site for TEA, but not tetramethyl (TMA),
in AQP1, resulting in a nearly 50% water permeability inhibition,
whichwas reduced inAQP1-Y186F due to effects on theTEA inhibitory binding region. Moreover, in the simulation TEA interacted
with charged residues in the C (Asp128) and E (Asp185) loop, and the
A(Tyr37-Asn42-Thr44) loop of the neighboring monomer, but not
directly with Tyr186. The loss of TEA inhibition in oocytes expressing properly folded AQP1-N42A or -T44A is in line with the computationally predicted binding mode. Our data reveal that the
molecular interaction of TEAwith AQP1 differs and is about 1000fold more effective on AQPs than on potassium channels. Moreover, the observed experimental and simulated similarities open the
way for rational design and virtual screening for AQP-specific
inhibitors, with quaternary ammonium compounds in general, and
TEA in particular as a lead compound.
Aquaporins form a large family of integral membrane proteins that
facilitate specific, efficient, and passive permeation of water, whereas
members of the aqua(glycero)porins also permeate small solutes, such
as glycerol and urea (1). In mammals, 13 different aqua(glycero)porins
have been identified, which differ in their tissues of expression, regulation, and selectivity. The gross structure of these membrane proteins is
conserved and consists of six transmembrane domains with cytoplasmic N and C termini. The 1st intracellular (B) and 2nd extracellular (E)
loop, both containing the highly conserved Asn-Pro-Ala (NPA)motive,
fold back into themembrane and form the central part of the water pore
(2, 3). Although every monomer is a functional water pore, aquaporins
are expressed as homotetramers (4, 5). The atomic structures of human
AQP13 (2) and GlpF from Eschericia coli (6), and real time molecular
dynamics (MD) studies of these proteins (7, 8) established themolecular
mechanism of water permeation.
Aquaporins are involved in the regulation of the water balance in
many tissues (1, 9). In the kidney, AQP1 is present in the proximal
tubules and thin descending limbs of Henle, in which almost 90% of the
180 liters of daily formed pro-urine is reabsorbed. The remaining volume is concentrated via the vasopressin-regulatedAQP2, which is present in the apical membrane of principal cells of the renal collecting duct
(10, 11), whereas AQP3 and AQP4, which are present in the basolateral
membrane of these cells, form the exit pathway of water to the interstitium (1, 12). Besides the kidney, AQP3 is also found in the gastrointestinal tract and the stratum corneum of the skin, where it exhibits a high
water permeability (13).
The clinical importance of AQPs is shown by their role in several
disturbed water balance disorders, which can severely affect the quality
of life and can be life threatening. The lack of AQP2 in states of excessive
water loss is fundamental to widely occurring nephrogenic diabetes
insipidus, a disease in which the kidney is unable to concentrate urine in
response to vasopressin (1, 14). In mice, lack of AQP3 also results in an
nephrogenic diabetes insipidus phenotype, indicating that AQP3might
also have an important role in urine concentration (15). AQP5 is present
in the lung and exocrine glands, such as salivary and sweat glands (16),
and the reduced saliva production in AQP5 knock-out mice underscores the important role of AQP5 in this process (17).
Paradoxically, disorders characterized by excessive water transport
have also shown or have been ascribed to AQPs. AQP1 has been shown
to be involved in tumor growth (18), and suggested to have a role in the
development of pulmonary edema, eye glaucoma, and cyst formation in
polycystic kidney disease (19). In several disorders, excessive renal water
uptake is due to high renal plasma membrane AQP2 expression, which
can lead to life threatening hyponatremia (20). AQP4 is, among other
tissues, expressed in cells lining brain ventricles and has been shown to
have a key role in the formation of brain edema (21), as a consequence of
hyponatremia, stroke, accidents, and cancer.
Considering the important roles of AQPs in excessive water transport, reversible aquaporin-specific blockers are clinically highly desira* This work was supported by European Union Grants QLRT-2000-00778 (to S. L. F., H. G.,
and P. M. T. D.) and QLK3-CT-2001-00987 (to H. G. and P. M. T. D.) and a grant from the
BBSRC (to S. L. F.). The costs of publication of this article were defrayed in part by the
payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
1 School of Chemistry and Manchester Interdisciplinary Biocentre, 131 Princess St.,
Manchester M1 7ND, UK.
2 To whom correspondence should be addressed: 286, Dept. of Physiology, RUNMC
Nijmegen, P. O. Box 9101, 6500 HB Nijmegen, The Netherlands. Tel.: 31-243617347;
Fax: 31-243616413; E-mail: p.deen@ncmls.ru.nl.
3 The abbreviations used are: AQP, aquaporin; MD, molecular dynamics; TEA, tetraethylammonium; TMA, tetramethyl; WT, wild type; ER, endoplasmic reticulum.
THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 281, NO. 20, pp. 14207–14214, May 19, 2006
© 2006 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A.
MAY 19, 2006 • VOLUME 281 • NUMBER 20 JOURNAL OF BIOLOGICAL CHEMISTRY 14207
at U
K
B
- U
niversiteitsbiblioteek N
ijm
egen on O
ctober 11, 2007
w w w .jbc.org
D
ow nloaded from
ble. Such blockers for AQP1, AQP2, and AQP3 could serve well as
diuretics and anti-tumor drugs (AQP1), whereas a timely administration of AQP4-specific blockers might reduce the formation of brain
edema. Such blockers, however, are yet not available. Mercury, silver,
and gold have been shown to inhibit AQPs (22, 23), but these metals are
highly toxic and their inhibition is not reversible. Recently, however, it
was reported that the ion channel blocker tetraethylammonium (TEA)
weakly inhibits AQP1-mediated water permeability in oocytes (24) and
mammalian cells (25). Because TEA can be chemically modified, it is
potentially a promising lead compound for the development of AQPspecific and selective blockers. Therefore, we here tested its selectivity
toward different water channels, determined its potency of inhibition
on different AQPs, and determined the TEA-active site in AQP1, using
a combination of an oocyte swelling assay, molecular docking, and MD
simulations.
EXPERIMENTAL PROCEDURES
Constructs—Expression constructs encoding human (h) AQP1 (pXgev1hAQP1; kind gift of Peter Agre (3)), pT7TshAQP2 (10), or pBSKSIIhAQP4 (26) were previously described. To generate pT7Ts-hAQP3, a
1444-bp BamHI-EcoRV fragment from pBSKSII hAQP3 (kind gift of Kenneth Ishibashi (27)) was cloned into the BglII/EcoRV sites of the oocyte
expression vector pT7Ts (10). To obtain pT7Ts-hAQP5, an 887-bp
BamHI/EcoRV fragment was cut from pBSKSII hAQP5 (kindly provided
by Peter Agre (28)) and cloned into the BglII/EcoRV sites of pT7Ts. With
the QuikChange site-directed mutagenesis kit (Stratagene, Heidelberg,
Germany), mutations were introduced into the human AQP1–5 cDNA
sequences, using the following forward primers: CTGGGCTTTAAATTCCCGGTG for Y37F, GGGAACGCCCAGACGGCGGTGCAGGAC
for N42A, CAACCAGGCGGCGGTGCAGGAC for T44A, CGCAATTCCCTGGCTGATGGTGTCAAC for D128S, GCTATTTCCTACAC-
CGGTTGTGGG for D185S, and GCTATTGACTTCACCGGTTGTGGGATTAACC for Y186F in AQP1; CCACCTCCTCGGGATCCATTTCACCGGCTGC for Y178F in AQP2; CATTGGCACCTCAAT-
GGGCTTCTACTCCGGCTATGC for N209Y in AQP3; GCAATCAATTTTACCGGTGCCAGC for Y185F in AQP4; GGAATCTACTACACCGGTTGCTCCATGAAC for F179Y in AQP5; and GTCGGAATCTTCTACACCGGTTGCTCCATGAAC for Y178F/F179Y in
AQP5.With these primers, restriction sites were introduced (DraI (Y37F),
BsgI (N42A/T44A), HincII (D128S), and AgeI in AQP4-Y185F, AQP5F179Y, andAQP5-Y178F/F179Y)ordeleted (BstXI forAQP2-Y178F,NcoI
site forAQP3-N209Y). Sequence analysis of selected clones confirmed that
only the desired mutations were introduced.
Water Permeability Measurements—Expression constructs were linearized with SalI (pT7TshAQP2, pT7TshAQP5), XbaI (pT7TshAQP3,
pBSKSIIhAQP4), or PstI (pXg-ev1hAQP1). G-capped cRNA transcripts were synthesized in vitro using T7 RNA polymerase (AQP2, -3,
and -5) or T3 RNA polymerase (AQP1 and -4). Transcription, and the
isolation, integrity checks, and determination of the concentration of
the cRNAs was done as described (29). Xenopus oocytes were isolated
and stored as described (30). The oocytes were injected with 0.2–0.5 ng
of cRNA coding for AQP1–5 and 0.5–1.0 ng of cRNA for the described
mutants. One day after injection the follicular membranes were
removed, and 2 days after injection the water permeability (Pf  S.E.;
N  8; in m/s) was measured using a standard swelling assay (10),
except that here ND96P saline buffer (96 mM NaCl, 2 mM KCl, 1.8 mM
CaCl2, 2.5 mM sodium pyruvate, 5 mM HEPES, pH 7.6, 200 mosM
ND96P) instead of modified Barth’s solution was used, because the
tested inhibitors were better soluble in ND96P. For the swelling assays,
ND96P was diluted 10 times withMilli-Q water. To test TEA-like compounds for their inhibitory activity, injected oocytes were pretreated
with the compound in ND96P for 15 min after which they were subjected to a swelling assay in 20 mosM ND96P in the presence of the
compound. Similar results were obtained without the preincubation
step. The data shown are an average of five experiments (with 5 different
batches of oocytes) in which 10 to 12 oocytes were tested at every condition. The Pf values under different conditions were compared within
one batch of oocytes. Themeasured Pf values were statistically analyzed
in an unpaired Student’s t test. p values  0.05 were considered significantly different. For the calculation of the IC50 values of potential blockers, the ratio of inhibition (I/I0) was determined, in which “I” is the Pf at
a certain inhibitor concentration and I0 is the Pf in the absence of inhibitor. Both values are corrected for the Pf of non-injected oocytes. The
I/I0 values of each individual experiment were plotted against corresponding TEA concentrations and subjected to the automatic curvefitting procedure inMicrosoft Excel. The IC50  S.E. values were calculated from four independent experiments.
Membrane Isolation and Immunoblotting—Total membranes and
plasma membranes were isolated from at least 8 oocytes per sample as
described (31). Protein samples were denatured by incubation for 30
min at 37 °C in Laemmli buffer and blotted as described (29). Next, the
blots were incubated overnight with 1:600 diluted mouse -AQP1 (32),
1:1500 diluted rabbit -AQP2 (29), or 1:500 diluted -AQP4 (33) in
TBST buffer (20 mM Tris, 140 mM NaCl, 0.1% Tween, pH 7.6) supplemented with 1% nonfat dried milk. As secondary antibodies, a 1:5000
dilution of goat -rabbit IgG (Sigma) for AQP2 and AQP4, or a 1:2000
dilution of sheep -mouse IgG (Sigma) for AQP1, both coupled to
horseradish peroxidase, were used. Finally, AQP proteins were visualized using enhanced chemiluminescence (Pierce).
Determination of TEA Docking Sites—The molecular docking package DOCK 4.0 (34) was used to dock TEA into the x-ray structure of
bovine AQP1 (Protein Data Bank code 1J4N). Atomic coordinates
including hydrogen atoms and charge information for TEA were generated using the SYBYL package from Tripos Inc. (SYBYL 6.9, Tripos
Inc., St. Louis, MI). A three-dimensional model of TEA was build using
the CONCORD (57) package. Using the SPHGEN program (35), clusters of overlapping spheres were created in the upper vestibule of bovine
AQP1. The original SPHGEN output file was edited using the InsightII
package (58) until a cluster of 16 spheres remained that filled the solvent
accessible surface area of AQP1. Hydrogens were added to the protein
and charged using a Gasteiger-Hückel potential. The Dock package
flexibly orientated the TEAmolecule within the defined docking region,
scoring and ranking the 100 best orientations. Orientationswere ranked
using the energy score of DOCK. The molecular visualization package
WITNOTP (59) was used to inspect TEA in the upper vestibule of
AQP1. Four representative orientations ofTEAwere selected as starting
positions for subsequent MD studies.
Molecular Dynamics Simulations—MD simulations were started
from the bovineAQP1 x-ray structure (PDB code 1J4N (36)), aftermodifying the structure to adopt the sequence of human AQP1. The 21
mutations and the insertion of 2 residues were carried out using the
WHAT IF package (37). The percentage of sequence identity is 90.63%.
None of the mutations or insertions is located in the pore region. AQP1
was simulated as a tetramer embedded in a solvated palmitoyloleoyl
phosphatidylethanolamine lipid bilayer. The simulation system contained 8,340 protein atoms, 14,093 lipid atoms, 19,769 SPC water molecules (38), and four chloride ions, resulting in a system size of 81,739
atoms. The simulation setup and conditions were identical to those
described before (7). In short, MD simulations were carried out using
theGromacs simulation suite (39). Lincs and Settle (40, 41)were applied
Aquaporin Blocking by Quaternary Ammonium Compounds
14208 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 281 • NUMBER 20 • MAY 19, 2006
at U
K
B
- U
niversiteitsbiblioteek N
ijm
egen on O
ctober 11, 2007
w w w .jbc.org
D
ow nloaded from
to constrain covalent bond lengths, allowing an integration time step of
2 fs. Electrostatic interactions were calculated using the Particle-Mesh
Ewald method (40). The temperature was kept constant by separately
coupling (  0.1 ps) the protein, lipids, and solvent to an external
temperature bath (42). The pressure was kept constant by weak coupling (  1.0 ps) in the z-direction (normal to the bilayer plane) to a
pressure bath (42). The gromacs force field was applied, which is the
gromos 87 force field (43) with slight modifications (44) and explicit
hydrogens on aromatic residues. To equilibrate the system, 500 ps of
MD were performed with harmonic position restraints on all non-hydrogen protein atoms (k  1000 kJ/(mol nm)). All subsequent simulations started from the resulting structure.
In total, seven simulations were performed, five of the wild type protein (WT), and two of the Y186F mutant. The simulation length of the
seven production runswas 15 ns for each of the simulations, totaling 105
ns of simulation time. For the simulations including TEA and tetramethyl (TMA), initial positions for the inhibitors were derived from the
docking approach described above. For WT_TEA1, TEA was placed at
four different docking positions within the four monomeric channels of
the tetramer, respectively (for the selection procedure of the docking
orientations, see above). After inserting the TEAmolecules, those water
molecules that showed significant overlap with the inhibitor were
removed from the simulation system. Because in this simulation TEA
remained stably bound to the protein only in one of the four positions
(see also “Results”), a second simulation (WT_TEA2) was started with
TEA molecules bound to this position in all four monomers. In both
simulations, to re-equilibrate the system, the position of the central
nitrogen atom of the TEA was kept fixed by a harmonic positional
restraint (k  10000 kJ/(mol nm)) for 500 ps. The third simulation
including TEA (WT_TEA3) started from the same conformation as
WT_TEA2, but the equilibration periodwas extended to 3 ns before the
production phase started. The WT_TMA simulation started, like the
WT_TEA1 simulation, with TMA bound to four different positions
obtained from the docking study described above. To all simulation
systems including TEA and TMA, four additional chloride ions were
added to compensate for the net charge of the quaternary ammonium
ions.
The starting structures for the simulations of the Y186F mutant,
Y186F_free and Y186F_TEA, were modeled from the structures, after
equilibration, of the WT_free and WT_TEA3 simulation, respectively,
by replacing the tyrosine hydroxide groups by a proton. Free energy
changes associated with the Y186F mutation were estimated with thermodynamic integration calculations. The difference in stability between
the WT and mutant protein was estimated from the free energy difference between the mutation in the folded protein and in a model of the
unfolded state (modeled as a tripeptide in solution). All thermodynamic
integration simulations were carried out using the method of slow
growth (45), i.e. by gradually introducing the mutation into the simulated system (using soft-core parameters  0 (resulting in linear interpolation of the non-bonded interactions) and   0.3 nm) during a
simulation period of 1 ns. For both the folded state and unfolded state
(tripeptide), forward and backwardmutations were simulated to ensure
that the mutation was sufficiently reversible and hysteresis effects were
small. For molecular visualization the pymol program (46) was used.
RESULTS
QuaternaryAmmoniumCompoundsTested onHumanAQP1—Brooks
et al. (24) recently reported that 100 M TEA could reversibly inhibit
water permeation through AQP1. To test whether we could reproduce
these data, Xenopus oocytes were injected with 0.2 ng of AQP1 cRNA
and tested in an oocyte-swelling assay in the presence or absence of 100
M TEA. Oocytes treated with TEA showed a reduced Pf of 44  14%
compared with controls (Fig. 1A). After subjection to a swelling assay in
the presence of TEA, oocytes were washed four times and allowed to
recover to the normal volume for 4 h. Subsequent analysis of these
oocytes in a swelling assay in the absence of TEA (Fig. 1A, wash)
revealed a Pf that was significantly higher than when they were treated
with TEA (p  0.038), and which was not significantly different from
AQP1-expressing control oocytes (p  0.074). These data confirm that
the water permeation through AQP1 can be reversibly inhibited
by TEA.
To determine whether the lengths of the carbon side chain of quaternary ammonium compounds affected the inhibition of AQP1 water
permeability, 100 M concentrations of TMA-, tetrapropyl- (TPrA),
tetrabutyl- (TBA), and tetrapentyl (TPeA) ammonium compounds
were tested on AQP1-expressing oocytes. Determination of the Pfs
revealed that, besides TEA, only TPrA significantly inhibited the AQP1
water permeability (32  15%; p  0.027; Fig. 1B). The inhibition by
FIGURE 1. Inhibition of the water permeability of AQP1-expressing oocytes by quaternary ammonium compounds. A, reversibility of inhibition by TEA. Treatment of
AQP1-expressing oocytes with 100 M TEA results in a 44  14% reduction of the water
permeability compared with untreated oocytes. After extensive washing (indicated) and
4 h recovery of the oocytes, determination of the water permeability revealed a significantly higher Pf compared with the TEA-treated oocytes; NI, non-injected controls; ,
without inhibitor; *, p  0.014; #, p  0.038. B, selectivity of AQP1 inhibition. AQP1expressing oocytes were incubated with 100 M quaternary ammonium salts with
methyl (TMA), ethyl (TEA), propyl (TPrA), butyl (TBA), or pentyl (TPeA) carbon side chains
and subjected to a standard swelling assay. Besides TEA, also TPrA showed a significant
inhibition of the water permeability; *, p  0.03. C and D, TEA and TPrA do not affect AQP
expression in the oolemma. Immunoblots of plasma membrane equivalents of AQP1 (C)
and AQP2 (D) expressing oocytes, isolated after incubation for 15 min with 100 M TMA,
TEA, or TPrA (indicated), revealed similar expression levels. A 2-fold dilution series of
oocytes expressing each was blotted in parallel.
Aquaporin Blocking by Quaternary Ammonium Compounds
MAY 19, 2006 • VOLUME 281 • NUMBER 20 JOURNAL OF BIOLOGICAL CHEMISTRY 14209
at U
K
B
- U
niversiteitsbiblioteek N
ijm
egen on O
ctober 11, 2007
w w w .jbc.org
D
ow nloaded from
TPrA was not significantly different from that of TEA and was thus as
effective as TEA at the tested concentration of 100 M.
In principle, the effect of TEA and TPrA on AQP1 water permeation
could be either a direct effect of the compound on AQP1 functioning or
a result of a reduced plasma membrane expression of AQP1 in the
presence of the blockers. To address this question, AQP1-expressing
oocytes were incubated with 100 M TMA, TEA, or TPrA for 15 min,
after which plasma membranes were isolated from eight oocytes in
duplicate and immunoblotted for AQP1 (Fig. 1C). Analysis of the
immunoblot signals revealed similar plasma membrane expression of
AQP1 for oocytes treated with TEA/TPrA versus TMA (p  0.11/0.20
respectively; n  4). As differences in AQP1 amounts revealed different
signal intensities at this exposure time (dilution series), this indicated
that the reduced water permeability with TEA or TPrA was due to a
direct inhibition of AQP1 instead of effects on the levels of AQP1
plasma membrane expression.
Screening of AQP2–5 for Inhibitory Effects of Quaternary Ammonium
Compounds—To determine whether the quaternary ammonium compounds specifically inhibit AQP1 or also affect the water permeation of
other AQPs, oocytes expressing human AQP2, AQP3, AQP4, or AQP5
were subjected to swelling assays in the presence or absence of 100 M
TMA, TEA, TPrA, TBA, or TPeA. Determination of the Pfs revealed
that, besides AQP1, the water permeability of AQP2 and AQP4 was
inhibited by TEA to 49  15 and 55  18%, respectively (data not
shown). In addition, the other four ammoniumcompounds did not have
a significant inhibitory effect on the water permeability of AQP2 or
AQP4, and the water permeability of AQP3 or AQP5 was not inhibited
by any of the compounds tested (data not shown).
The AQP1 inhibitors TEA and TPrA did not affect AQP1 plasma
membrane expression (Fig. 1C). To test whether the same holds for
AQP2, oocytes expressingAQP2were incubatedwithTMAorTEAand
plasma membranes were isolated as above. Subsequent immunoblotting for AQP2 revealed similar AQP2 plasma membrane expression
levels for oocytes treated with TMA versus TEA (p  0.34; n  4; Fig.
1D), which indicated that TEA also directly affects AQP2 water permeability, instead of reducing its expression in the oolemma.
Potency of TEA to Inhibit AQP1, -2, and -4 Water Permeation—As
shown in Fig. 1B, the level of water permeability inhibition through
AQP1 was similar for TEA and TPrA at 100 M concentration. To
determine the potency of each compound, AQP1-expressing oocytes
were subjected to swelling assays in the absence or presence of 4 or 100
M of each inhibitor. Determination of the Pf revealed that the inhibition with 4 M TEA (42  11%) was high and not significantly different
from that of 100MTEA (40 14%; Fig. 2A). In contrast, no significant
inhibition was observed with 4 M TPrA, whereas 100 M TPrA again
showed a significant inhibition of 29  12%. This indicates that the
potency of TEA to inhibit AQP1 water permeation is higher than of
TPrA.
TEA inhibited thewater permeability of AQP1, AQP2, andAQP4. To
determine the potency of TEA for these different AQPs, oocytes
expressing each AQP were subjected to swelling assays with different
concentrations of TEA to determine the IC50 values forAQP1, -2, and -4
(Fig. 2B). Interestingly, AQP1, AQP2, and AQP4 appeared to have different IC50 values for TEA. For AQP1, a 46% inhibition of the water
permeability was already observed at 4 M TEA, which was not further
increased for concentrations up to 100 M or above (Fig. 2B). The
obtained IC50 value of TEA for AQP1 appeared to be 1.4  0.8 M. The
observed IC50 values for AQP2 and AQP4 were 6.2  1.9 and 9.8  2.3
M, respectively, whereas the maximum level of inhibition by TEA was
40 12% for AQP2 and 57 9% for AQP4. These results indicated that
the potency of TEA to inhibit water permeation through AQP1 is 4–6
times higher than for AQP2 or AQP4.
The Involvement of a Tyrosine Residue in the E-loop for TEA Inhibition—The water permeation of AQP1-Y186F, in which Tyr186 in the
E-loop is replaced by Phe, was no longer sensitive to TEA, which indicated an involvement of Tyr186 in binding TEA (24). Interestingly, an
alignment of the amino acid sequences of the E-loop of human AQP1,
-2, -3, -4, and -5 shows that Tyr186 is conserved in AQP1, -2, and -4 (Fig.
3A), which are all inhibited by TEA. In contrast, AQP3 and AQP5,
which are not inhibited by TEA, have Asn and Phe residues at this
position, respectively.
To further explore an involvement of this Tyr in the inhibition of
water permeation by TEA, Tyr186 in hAQP1, Tyr178 in hAQP2, and
Tyr185 in hAQP4 were replaced by Phe. Introduction of amino acid
changes in AQP1–4 can result in their misfolding, which will lead to a
predominant retention in the endoplasmic reticulum (ER) and immunoblot detection of high mannose-glycosylated AQP1/2/4 of around 32
kDa (14, 47–49). To avoid working with such proteins, because we
cannot be confident about their proper structure, total membranes of
oocytes expressing the WT and mutant AQPs 1, 2, or 4 were subjected
to immunoblot analysis. In contrast to the ER-retained AQP2 mutant
control, AQP2-T126M (49), a 32-kDa band was not observed for any of
the AQP1/2/4 mutants (Fig. 3B), indicating their proper folding. Subsequent analysis of their water permeability in the presence or absence of
100 M TEA revealed that AQP1-Y186F, AQP2-Y178F, and AQP4Y185F were functional water channels, which showed no statistically
significant inhibition by TEA anymore (Fig. 3C).
FIGURE 2. The potency of TEA and TPrA to inhibit AQP1, -2, and -4 water permeation.
A, potency of AQP1 inhibitors. Water permeabilities (Pf) of AQP1-expressing oocytes
incubated with 4 or 100 M tetraethylammonium or tetrapropylammonium (TPrA). TEA
was fully inhibited at both concentrations, whereas no significant inhibition was
observed for 4 M TprA; NI, non-injected control; , without inhibitor; *, p  0.02. B,
determination of the IC50 concentrations. AQP1-, AQP2-, or AQP4-expressing oocytes
were incubated with different concentrations of TEA and subjected to a standard swelling assay. The IC50 value of TEA for AQP1 (F) is 1.4  0.8 M, for AQP2 (), 6.2  1.9 M;
and for AQP4 (f), 9.8  2.3 M.
Aquaporin Blocking by Quaternary Ammonium Compounds
14210 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 281 • NUMBER 20 • MAY 19, 2006
at U
K
B
- U
niversiteitsbiblioteek N
ijm
egen on O
ctober 11, 2007
w w w .jbc.org
D
ow nloaded from
To investigate whether introduction of a Tyr at a corresponding position in AQP3 or AQP5 would result in TEA-sensitive water permeability, mutants weremade in which a tyrosine was exchanged for Asn209 in
AQP3 and Phe179 in AQP5. Because AQP5 has a Tyr residue at position
178, another AQP5 mutant was made in which residues 178 and 179
were swapped (i.e. Tyr178/Phe179 changed into Phe178/Tyr179). Subsequent immunoblot and swelling assays of the encoded proteins showed
that none of the AQP3/5 mutants was misfolded and that they formed
functional channels, which were not significantly inhibited by TEA
(data not shown).
Together, these data indicated that the loss of swelling inhibition by
TEA in AQP1, AQP2, and AQP4 is only because of the Tyr to Phe
mutations, but that the introduction of a Tyr residue at the corresponding sites in AQP3/5 did not result in TEA-sensitive water permeability.
Molecular Docking of TEA—To identify the binding site of TEA in
AQP1, TEA was subjected to docking studies in the upper vestibule of
AQP1.Analysis of the obtained data revealed that TEAwas able tomove
freely within the defined docking region. Of the 100 best scored orientations, the majority of TEA orientations showed little bias to any specific group of AQP1 residues. Four representative AQP1-TEA starting
orientations generated byDOCKwere selected for subsequentMDsimulations. These docked TEA orientations satisfied basic steric and electrostatic considerations and were chosen to be as spatially distinct from
each other as possible.
Molecular Dynamics Simulations of AQP1 Inhibition by TEA—Fig.
4a shows the four initial positions of TEA, one in each monomer,
obtained from the docking study, which formed the starting structure of
simulation WT_TEA1. In this simulation, only one TEA stayed bound
during the 15-ns simulation time. To better characterize this binding
site, and to obtain better statistics, TEAwas placed at this position in all
four monomers, and two subsequent simulations were carried out, differing from each other in the relaxation time (500 ps forWT_TEA2 and
3 ns for WT_TEA3). In WT_TEA2 only one TEA stayed bound during
the 15-ns simulation time,whereas inWT_TEA3 all fourTEA remained
bound. This striking difference suggests that induced-fit relaxation
motions do occur at a nanosecond time scale and likely affect theAQP1TEA interactions. In contrast, TMA did not bind in any of the four
positions studied, which is in agreement with the results from swelling
assays (Fig. 1B). In Y186F_TEA, two TEAmolecules stayed bound during the 15-ns simulation time.
FIGURE 3. The role of E-loop tyrosine residues in TEA-mediated inhibition of the
water permeability of AQP1–5. A, amino acid alignment of the E-loops of human
AQP1–5. The conserved NPA box is underlined, *, indicates the tyrosine residue that is
conserved in the TEA-sensitive water channels. B, expression forms of wild-type and Tyr
to Phe mutants of AQP1, -2, and -4. Immunoblots of total membrane equivalents of
oocytes expressing wild type or Tyr to Phe mutant proteins of AQP1, -2, and -4 treated
with () or without () TEA revealed only 29-kDa proteins, which indicated that the
mutant proteins are properly folded. The inset marked with an asterisk shows a typical
example of an ER-retarded AQP2 mutant (AQP2-T126M), which, besides the 29-kDa
band, also shows the high mannose-glycosylated band of 32 kDa. C, the role of E-loop
tyrosines in TEA-inhibited water permeation. The water permeabilities of oocytes
expressing WT-AQP1, -2, or -4 or their Tyr to Phe mutants were measured in the absence
() or presence () of 100 M TEA. The permeabilities are expressed in % related to
untreated oocytes expressing the WT-AQPs. The water permeabilities of oocytes
expressing WT-AQP1, -AQP2, or -AQP4 were inhibited 42  11 ( p  0.008), 48  23 ( p 
0.021), or 47  22% (p  0.026), respectively.
FIGURE 4. Molecular dynamics simulations on
TEA binding to AQP1. a, starting configurations
for the MD simulations described in the text. TEA
molecules (space-filling representation) at four
representative TEA positions out of 100 nearly
equally scored docking results were included. b,
histogram of the nitrogen atom positions for the
quaternary ammonium ions as a function of the
pore axis. The WT_TEA3 simulations have been
used to define the inhibitor binding region (IBR). c,
representative snapshot of the TEA binding site.
TEA is embedded in a pocket built by the C-loop
(marine), and E-loop (cyan) of one and the A-loop
(magenta) of the neighboring monomer. Mutations to validate the predicted binding site are
represented as sticks (red for the properly folded
and gray for the others). d, effect of inhibitor binding on water mobility in the pore: the number of
water molecules that pass 0.5-nm thick slices during the MD simulations as a function of the pore
axis. The water flux in simulation for WT_TEA3 in
the NPA, aromatic arginine (ar/R), and the IBR
region is lower than in the mutant and the inhibitor simulations.
Aquaporin Blocking by Quaternary Ammonium Compounds
MAY 19, 2006 • VOLUME 281 • NUMBER 20 JOURNAL OF BIOLOGICAL CHEMISTRY 14211
at U
K
B
- U
niversiteitsbiblioteek N
ijm
egen on O
ctober 11, 2007
w w w .jbc.org
D
ow nloaded from
Fig. 4b shows histograms of TEA positions along the pore axis z.
Because all four TEAmolecules remained bound during the 15-ns simulation time, WT_TEA3 (black curve) was used to define an inhibitor
binding region between 63 and 67 Å along the pore axis z. The shape of
the WT_TEA2 curve (red) is similar to the one of WT_TEA3, but is
shifted by about 4 Å toward the extracellular surface, indicating that the
unbound TEA molecules stayed close to the protein surface. Visual
inspection of the trajectory showed that one TEA bound to the central
pore of the tetramer and not at the pore entry sites. In WT_TEA1
(green) the curve is wider because of the different starting positions and
the fast unbinding of TEA from the three unstable positions. No TMA
molecule bound to AQP1, as reflected in the wide density profile in
the pore axis z of WT_TMA (blue). Remarkably, the sharp peak of
Y186F_TEA (orange) is shifted by about 1 Å toward the extracellular
surface, i.e. the two TEA molecules bound at positions located slightly
toward the outside of the pore as compared with the WT.
The six monomers (from different simulations) in which TEA remained boundwere used to characterize the interactions with the binding site. As shown in a representative snapshot (Fig. 4c) the binding site
contains contributions from the C- (marine) and E-loops (cyan). Additionally, in the simulation the A-loop (magenta) of the neighboring
monomer covered the binding site much like a lid, which suggests an
important role in TEA binding. In our simulations, Tyr186 formed no
direct contacts to TEA.
To study the influence of the TEA onwater permeability, we counted
the number of water molecules passing slices (of 5 Å thickness each) of
the pore during the simulations (Fig. 4d). In these curves, the point of
lowestmobility is expected to dominate the overall permeability. As can
be seen, the water permeability is significantly larger in WT_free (purple) than, e.g. in the WT_TEA3 simulation, where all four TEA molecules stayed bound. This effect is particularly pronounced in the TEA
binding region, where the water flux through the 5-Å thick layers in
WT_free is 10–15 times higher than in WT_TEA3. These results
strongly suggest that the water permeability of AQP1 is indeed significantly reduced by the binding of TEA.
To study why Y186F changes the inhibitory activity of TEA on AQP1
despite the fact that it is not located directly at the putative binding site
(see Fig. 4d), we performed thermodynamic integration simulations for
this mutation. The obtained relatively small free energy difference of
G  20 kJ/mol between the WT and the mutant suggests that the
mutant leaves the protein structure mostly intact and, therefore the
model provides a reliable basis for subsequentmolecular dynamics simulations. Accordingly, we performed two 15-ns MD simulations of the
mutant with and without bound TEA. The water flux analysis (Fig. 4d)
of the mutant without TEA (Y186F_free, dotted magenta curve) and
with TEA (Y186F_TEA, dotted orange curve) show amuch smaller TEA
effect than observed forwild-typeAQP1,which is in full agreementwith
the oocyte measurements.
Exploring the Putative TEA-binding Sites in AQP1—The molecular
dynamics simulations provided a model for the binding mode of TEA.
To validate this prediction, in vitro mutagenesis was employed to
change the residues interacting with TEA (Y37F, N42A, T44A, D128S,
and D185S). Expression in oocytes revealed that AQP1-N42A, AQP1T44A, andWT-AQP1weremainly expressed as 28-kDa bands, whereas
all others showed strong ER-glycosylation forms, indicating that these
latter proteins are not properly folded (Fig. 5A). However, N42A and
T44A eliminate the AQP1 N-glycosylation consensus site (50) and,
therefore, analysis of their glycosylation state is not informative on their
proper folding. Therefore, we analyzed their ratio of plasma membrane
versus totalmembrane expression, as this is strongly reducedwith improperly folded AQPs (31, 51). Immunoblot analysis, however, revealed that
this ratio was not significantly different compared withWT-AQP1 (not
shown). These data indicate that AQP1-N42A and T44A are properly
folded and underscore findings obtained with AQP1-N42Q and AQP2N123Q that glycosylation is not required for folding, oligomerization,
cell surface expression, and function of AQPs in oocytes (50, 52). Subsequent swelling assays of the properly folded proteins revealed that the
water permeability of WT-AQP1, but not of AQP1-N42A or AQP1T44A, was inhibited by TEA (Fig. 5B).
DISCUSSION
TEA Potently and Reversibly Inhibits Water Permeation through
AQP1—We found that TEA reversibly inhibited AQP1 water permeation, in agreement with earlier findings (24). The unchanged plasma
membrane expression levels in our studies of AQP1 (and AQP2) in
oocytes treated with or without TEA, furthermore, indicated that the
observed inhibitory effect is because of a direct effect on the particular
AQP. This finding is corroborated by the absence of any effect of TEA
on the water permeation conferred by AQP3, AQP5, and their E-loop
tyrosine mutants (Fig. 3).
Compared with the results reported by Brooks et al. (24) the levels of
AQP1 inhibitionwere considerably higher in our experiments.Whereas
Brooks et al. (24) observed a 30% inhibition with 100 M TEA and a
significant inhibition at 50 M or higher, we found a maximal level of
nearly 50% inhibition for 4–100 MTEA and an IC50 of around 1.4 M.
Similarly, whereas Brooks et al. (24) did not observe any inhibition of the
AQP1water permeation by TPrA, we found a significant 32% inhibition
with this compound (Fig. 1). These differences might be due to the
higher amounts of AQP1 cRNA injected by Brooks et al. (24) or, possibly, the apparent high variability in Pfs in their experiments (33–60%).
TEA Also Inhibits AQP2 and AQP4 Water Permeation—Besides
AQP1, TEA also inhibits water permeation through AQP2 and AQP4,
whereas the water permeabilities of oocytes expressing AQP3 or AQP5
were not affected. Although TEA could act on any part of the AQP
protein, the convincing evidence that the E-loop forms the extracellular
FIGURE 5. Functional analysis of putative TEA binding sites in AQP1. A, human WTAQP1 or its mutants encoding Y37F, N42A, T44A, D128S, D185S, or the Y37F/D128S/
D185S triple mutant were expressed in oocytes and analyzed for expression by immunoblotting. Except for WT-AQP1, and its N42A and T44A mutants, all mutant proteins
revealed a 30-kDa band, besides the 28-kDa band, indicating to ER retention and misfolding. Molecular mass is indicated on the left in kDa. B, water permeabilities (Pf) of
oocytes expressing WT-AQP1, AQP1-N42A, or AQP1-T44A in the presence or absence of
100 M TEA. *, p  0.05.
Aquaporin Blocking by Quaternary Ammonium Compounds
14212 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 281 • NUMBER 20 • MAY 19, 2006
at U
K
B
- U
niversiteitsbiblioteek N
ijm
egen on O
ctober 11, 2007
w w w .jbc.org
D
ow nloaded from
face of the water pore (2, 3) and the loss of TEA inhibition with the
E-loop Tyr to Phe mutants of AQP1, AQP2, and AQP4 strongly indicated that the binding site for TEA is in the vicinity of the E-loop (see
also below). Similar to AQP1, inhibition by TEA leveled off for AQP2
and AQP4, although here at nearly 40 and 60% inhibition, respectively
(Fig. 2B). The IC50 value for AQP1, however, was considerably lower
than for AQP2 or AQP4 (1.4 M versus 6.2 and 9.8, respectively), which
shows that TEA is a more potent inhibitor of AQP1. This suggests that,
although the E-loops of the water-selective channels AQP1, -2, and -4
are quite homologous, their vestibules do differ. This is underscored by
our finding that TPrA does inhibit water permeation in AQP1, but not
in AQP2 or AQP4. Assuming a similar mode of action as for TEA, the
inhibition ofAQP1byTPrA, but not byTMA,TbuA, orTPeA, indicates
that indeed specifically designed TEA derivatives may prove to be
potential specific AQP blockers.
Several Residues Constitute the TEA Binding Site in AQP1—Water
and potassium channels appear to share several features, although they
are evolutionary distinct. Similar to AQPs, many potassium channels
are homotetramers of 6 (and sometimes 2) -helical transmembrane
domains of which the last two are involved in the formation of the
K-selective pore, which is about 3 Å at its narrowest point (53, 54). In
potassium channels, aromatic residues at the extracellular mouth of the
selectivity filter are thought to mediate binding to TEA (55, 56). Similarly, it has been suggested that Tyr186 in AQP1 is involved in TEA
binding (24). Indeed, AQP1, AQP2, and AQP4, which all have a Tyr at a
similar position, were inhibited by TEA, whereas AQPs that had a Tyr
residue at another distance from the NPA box (AQP5) or had no Tyr
residue at all in its E-loop (AQP3) were not inhibited by TEA. Also, the
Tyr to Phe mutants of AQP1, AQP2, and AQP4, which were functional
water channels, lacked inhibition by TEA (Fig. 3). All these mutants
were properly folded, as judged by the absence of ER-glycosylated forms
with immunoblot analyses (Fig. 3C) as well as by our thermodynamic
integration simulations, which suggested that the Y186Fmutation does
not significantly destabilize the protein structure. This latter conclusion
is corroborated by free molecular dynamics simulations of the mutant,
which did not exhibit significant structural changes (simulation Y186F_
free; Fig. 4).
The experiments above, however, do not exclude the possibility that
TEA binds to residues other than Tyr186 and that the loss of inhibition
by TEA with the Tyr to Phe mutations is because of other structural
changes in AQP1. Although not conclusive, the fact that introducing a
Tyr residue at the corresponding position does not introduce sensitivity
to TEA in AQP3/AQP5 indicates that a Tyr at that position alone is not
sufficient for TEA sensitivity. Also, the particular Tyr residue inAQP1 is
located at the rim of the water pore (Fig. 4), which is relatively far from
theAQP1water pore aromatic arginine region (ar/R) and suggested that
this residue may indirectly affect TEA affinity. Indeed, our simulations
indicate that the binding site is mainly formed by amino acids located in
A-loop (Tyr37, Asn42, Thr44, and Asp48), C-loop (Asp128), and E-loop
(Asp185), whereas Tyr186 is not directly involved in TEA binding.
Instead, the Y186Fmutation seems to influence the structural flexibility
of parts of the protein, especially the A-loop (simulation Y186F_TEA).
The lack of water permeability inhibition by TEAmediated by the properly foldedAQP1-N42A andAQP1-T44Aproteins underscores the role
of these residues in inhibitor binding. Intriguingly, however, Asn42 and
Thr44 are essential for AQP1 glycosylation (50). Whether glycosylation
may be involved in inhibitor binding and how the mutant Y186F changes
the affinity of AQP1 for TEAwill be the subject of future studies.
Our computational characterization of the binding site introduces a
new viewpoint on TEA binding in AQP1. Up to now, studies in oocytes
to investigate TEA binding modes only focused on mutations in the
E-loop.Our simulations provide an extended picture of TEAbinding. In
particular, the A-loop of the neighboring monomer might function as a
lid, which hinders TEA to leave the binding site. TEA, but not TMA,
bound at this binding pocket, exhibits an inhibition that is of the same
order of magnitude as that observed experimentally in oocytes.
In conclusion, we have shown that TEA shows a reversible and selective inhibition of water permeation through AQP1, AQP2, and AQP4
and that this inhibition is likely mediated through an interaction
betweenTEA and amino acids located at the extracellular face of AQP1,
especially the A-, C-, and E-loops. The IC50 values of TEA for AQP1, -2,
and -4 are in the micromolar region (1.4, 6.2, and 9.4 M), which indicates that quaternary ammonium compounds in general and TEA in
particular are good lead compounds for the development of reversible
and AQP-specific inhibitors in clinical applications. Moreover, the
molecular characterization of the TEA binding site, corroborated by
mutational studies, opens new perspectives for a rational structurebased approach to search for more efficient and selective blockers of
different aquaporins.
Acknowledgments—We are indebted to Drs. Peter Agre, Johns Hopkins University, Baltimore, MD, and Kenneth Ishibashi, Department of Pharmacology,
JichiMedical School, Tochigi, Japan, for providing human AQP1/5 and AQP3
expression constructs, respectively.
REFERENCES
1. Nielsen, S., Frokiaer, J., Marples, D., Kwon, T. H., Agre, P., and Knepper, M. A. (2002)
Physiol. Rev. 82, 205–244
2. Murata, K., Mitsuoka, K., Hirai, T., Walz, T., Agre, P., Heymann, J. B., Engel, A., and
Fujiyoshi, Y. (2000) Nature 407, 599–605
3. Jung, J. S., Preston, G. M., Smith, B. L., Guggino, W. B., and Agre, P. (1994) J. Biol.
Chem. 269, 14648–14654
4. VanHoek, A. N., Hom,M. L., Luthjens, L. H., de Jong,M. D., Dempster, J. A., and van
Os, C. H. (1991) J. Biol. Chem. 266, 16633–16635
5. Smith, B. L., and Agre, P. (1991) J. Biol. Chem. 266, 6407–6415
6. Fu, D., Libson, A., Miercke, L. J., Weitzman, C., Nollert, P., Krucinski, J., and Stroud,
R. M. (2000) Science 290, 481–486
7. de Groot, B. L., and Grubmuller, H. (2001) Science 294, 2353–2357
8. Tajkhorshid, E., Nollert, P., Jensen, M. O., Miercke, L. J., O’Connell, J., Stroud, R. M.,
and Schulten, K. (2002) Science 296, 525–530
9. van Os, C. H., Kamsteeg, E. J., Marr, N., and Deen, P. M. T. (2000) Pflugers Arch. 440,
513–520
10. Deen, P.M. T., Verdijk,M. A. J., Knoers, N. V. A.M.,Wieringa, B.,Monnens, L. A. H.,
van Os, C. H., and van Oost, B. A. (1994) Science 264, 92–95
11. Fushimi, K., Uchida, S., Hara, Y., Hirata, Y., Marumo, F., and Sasaki, S. (1993)Nature
361, 549–552
12. Deen, P. M. T., Van Balkom, B.W.M., and Kamsteeg, E. J. (2000) Eur. J. Cell Biol. 79,
523–530
13. Sougrat, R., Morand, M., Gondran, C., Barre, P., Gobin, R., Bonte, F., Dumas, M., and
Verbavatz, J. M. (2002) J. Investig. Dermatol. 118, 678–685
14. Knoers, N. V. A. M., and Deen, P. M. T. (2001) Pediatr. Nephrol. 16, 1146–1152
15. Ma, T., Song, Y., Yang, B., Gillespie, A., Carlson, E. J., Epstein, C. J., andVerkman, A. S.
(2000) Proc. Natl. Acad. Sci. U. S. A. 97, 4386–4391
16. Song, Y., Sonawane, N., and Verkman, A. S. (2002) J. Physiol. 541, 561–568
17. Ma, T., Song, Y., Gillespie, A., Carlson, E. J., Epstein, C. J., and Verkman, A. S. (1999)
J. Biol. Chem. 274, 20071–20074
18. Saadoun, S., Papadopoulos, M. C., Hara-chikuma, M., and Verkman, A. S. (2005)
Nature 434, 786–792
19. King, L. S., and Agre, P. (1996) Annu. Rev. Physiol. 58, 619–648
20. Pedersen, R. S., Bentzen, H., Bech, J. N., Nyvad, O., and Pedersen, E. B. (2003) Kidney
Int. 63, 1417–1425
21. Manley, G. T., Fujimura, M., Ma, T., Noshita, N., Filiz, F., Bollen, A.W., Chan, P., and
Verkman, A. S. (2000) Nat. Med. 6, 159–163
22. Preston, G. M., Jung, J. S., Guggino, W. B., and Agre, P. (1993) J. Biol. Chem. 268,
17–20
23. Niemietz, C. M., and Tyerman, S. D. (2002) FEBS Lett. 531, 443–447
24. Brooks, H. L., Regan, J. W., and Yool, A. J. (2000)Mol. Pharmacol. 57, 1021–1026
25. Yool, A. J., Brokl, O.H., Pannabecker, T. L., Dantzler,W.H., and Stamer,W.D. (2002)
Aquaporin Blocking by Quaternary Ammonium Compounds
MAY 19, 2006 • VOLUME 281 • NUMBER 20 JOURNAL OF BIOLOGICAL CHEMISTRY 14213
at U
K
B
- U
niversiteitsbiblioteek N
ijm
egen on O
ctober 11, 2007
w w w .jbc.org
D
ow nloaded from
BMC Physiol. 2, 4
26. Lu, M., Lee, M. D., Smith, B. L., Jung, J. S., Agre, P., Verdijk, M. A. J., Merkx, G., Rijss,
J. P. L., and Deen, P. M. T. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 10908–10912
27. Ishibashi, K., Sasaki, S., Fushimi, K., Uchida, S., Kuwahara,M., Saito, H., Furukawa, T.,
Nakajima, K., Yamaguchi, Y., andGojobori, T. (1994) Proc. Natl. Acad. Sci. U. S. A. 91,
6269–6273
28. Lee, M. D., Bhakta, K. Y., Raina, S., Yonescu, R., Griffin, C. A., Copeland, N. G.,
Gilbert, D. J., Jenkins, N. A., Preston, G. M., and Agre, P. (1996) J. Biol. Chem. 271,
8599–8604
29. Deen, P. M. T., Croes, H., van Aubel, R. A., Ginsel, L. A., and van Os, C. H. (1995)
J. Clin. Investig. 95, 2291–2296
30. Mulders, S. M., Bichet, D. G., Rijss, J. P. L., Kamsteeg, E. J., Arthus, M. F., Lonergan,
M., Fujiwara, M., Morgan, K., Leijendekker, R., van der Sluijs, P., van Os, C. H., and
Deen, P. M. T. (1998) J. Clin. Investig. 102, 57–66
31. Kamsteeg, E. J., and Deen, P. M. T. (2001) Biochem. Biophys. Res. Commun. 282,
683–690
32. Deen, P. M. T., Nielsen, S., Bindels, R. J. M., and van Os, C. H. (1997) Pflugers Arch.
433, 780–787
33. Van Balkom, B. W. M., Van Raak, M., Breton, S., Pastor-Soler, N., Bouley, R., van der
Sluijs, P., Brown, D., and Deen, P. M. T. (2003) J. Biol. Chem. 278, 1101–1107
34. Ewing, T. J., and Kuntz, I. D. (1997) J. Comp. Chem. 18, 1175–1189
35. Kuntz, I. D., Blaney, J. M., Oatley, S. J., Langridge, R., and Ferrin, T. E. (1982) J. Mol.
Biol. 161, 269–288
36. Sui, H., Han, B. G., Lee, J. K., Walian, P., and Jap, B. K. (2001) Nature 414, 872–878
37. Vriend, G. (1990) J. Mol. Graph. 8, 52–56, 29
38. Berendsen, H. J., Postma, J. P., van Gunsteren, W. F., and Hermans, J. (2004) in
Intermolecular Forces (Pullman, B., ed) D. Reidel Publishing Company, Dordrecht
39. Lindahl, E., Hess, B., and van der Spoel, D. (2001) J. Mol. Model. 7, 306–317
40. Hess, B., Bekker, H., Berendsen, H. J., and Fraaije, J. G. (1997) J. Comp. Chem. 18,
1463–1472
41. Miyamoto, S., and Kollman, P. A. (1992) J. Comp. Chem. 13, 952–962
42. Berendsen, H. J., Postma, J. P., DiNola, A., and Haak, J. R. (1984) J. Chem. Phys. 81,
3684–3690
43. van Gunsteren, W. F., and Berendsen, H. J. (1987) GROMOS Manual, BIOMOS,
Biomolecular Software, Laboratory of Physical Chemistry, University of Groningen,
The Netherlands
44. Van Buuren, A. R., Marrink, S.-J., and Berendsen, H. J. C. (1993) J. Phys. Chem. 97,
9206–9212
45. Bash, P. A., Singh, U. C., Langridge, R., and Kollman, P. A. (1987) Science 236,
564–568
46. DeLano, W. L. (2002) The PyMOL Molecular Graphics System, DeLano Scientific,
San Carlos, CA
47. Mulders, S. M., van der Kemp, A. J., Terlouw, S. A., van Boxtel, H. A. F., vanOs, C. H.,
and Deen, P. M. T. (1998) Pflugers Arch. 436, 599–607
48. Marr, N., Bichet, D. G., Hoefs, S., Savelkoul, P. J., Konings, I. B., De Mattia, F., Graat,
M. P., Arthus, M. F., Lonergan, M., Fujiwara, T. M., Knoers, N. V. A. M., Landau, D.,
Balfe, W. J., Oksche, A., Rosenthal, W., Muller, D., van Os, C. H., and Deen, P. M. T.
(2002) J. Am. Soc. Nephrol. 13, 2267–2277
49. Mulders, S. M., Knoers, N. V. A. M., van Lieburg, A. F., Monnens, L. A. H., Leumann,
E., Wuhl, E., Schober, E., Rijss, J. P. L., van Os, C. H., and Deen, P. M. T. (1997) J. Am.
Soc. Nephrol. 8, 242–248
50. Preston, G. M., Jung, J. S., Guggino, W. B., and Agre, P. (1994) J. Biol. Chem. 269,
1668–1673
51. Marr, N., Kamsteeg, E. J., Van Raak, M., van Os, C. H., and Deen, P. M. T. (2001)
Pflugers Arch. 442, 73–77
52. Hendriks, G., Koudijs, M., van Balkom, B. W., Oorschot, V., Klumperman, J., Deen,
P. M. T., and van der Sluijs, P. (2004) J. Biol. Chem. 279, 2975–2983
53. Blaustein, R. O., and Miller, C. (2004) Nature 427, 499–500
54. Doyle, D. A., Morais, C. J., Pfuetzner, R. A., Kuo, A., Gulbis, J. M., Cohen, S. L., Chait,
B. T., and MacKinnon, R. (1998) Science 280, 69–77
55. MacKinnon, R., and Yellen, G. (1990) Science 250, 276–279
56. Zhou, M., Morais-Cabral, J. H., Mann, S., and MacKinnon, R. (2001) Nature 411,
657–661
57. Pearlman, R. S. (1998) CONCORD User’s Manual, Tripos Inc., St. Louis, MO
58. Accelrys Inc. (2000) InsightIIModeling Environment, Release 2000, Accelrys Inc., San
Diego, CA
59. Widmer, A. (1997) WITNOTP: A Computer Program for Molecular Modeling,
Novartis, Basel, Switzerland
Aquaporin Blocking by Quaternary Ammonium Compounds
14214 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 281 • NUMBER 20 • MAY 19, 2006
at U
K
B
- U
niversiteitsbiblioteek N
ijm
egen on O
ctober 11, 2007
w w w .jbc.org
D
ow nloaded from

PDF Document reader online

This website is focused on providing document in readable format, online without need to install any type of software on your computer. If you are using thin client, or are not allowed to install document reader of particular type, this application may come in hand for you. Simply upload your document, and Docureader.top will transform it into readable format in a few seconds. Why choose Docureader.top?

  1. Unlimited sharing - you can upload document of any size. If we are able to convert it into readable format, you have it here - saved for later or immediate reading
  2. Cross-platform - no compromised when reading your document. We support most of modern browers without the need of installing any of external plugins. If your device can oper a browser - then you can read any document on it
  3. Simple uploading - no need to register. Just enter your email, title of document and select the file, we do the rest. Once the document is ready for you, you will receive automatic email from us.

Previous 10

Next 10