Glucosylated Cholesterol In Mammalian Cells And Tissues - ...

Copy and paste this link to your website, so they can see this document directly without any plugins.



Keywords

GlcChol, with, were, cells, GBA2, cholesterol, from, mice, that, GlcCer, using, plasma, Figure, activity, type, presence, disease, (Figure, GBA3, Gaucher, formation, patients, rGBA, enzyme, transglucosylation, COS-7, tissues, lysates, analyzed, this

Transcript

UvA-DARE is a service provided by the library of the University of Amsterdam (http://dare.uva.nl)
UvA-DARE (Digital Academic Repository)
Lysosomal glycosidases and glycosphingolipids: New avenues for research
Rosa Alcalde Marques, André
Link to publication
Citation for published version (APA):
Rosa Alcalde Marques, A. (2016). Lysosomal glycosidases and glycosphingolipids: New avenues for research
General rights
It is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s),
other than for strictly personal, individual use, unless the work is under an open content license (like Creative Commons).
Disclaimer/Complaints regulations
If you believe that digital publication of certain material infringes any of your rights or (privacy) interests, please let the Library know, stating
your reasons. In case of a legitimate complaint, the Library will make the material inaccessible and/or remove it from the website. Please Ask
the Library: http://uba.uva.nl/en/contact, or a letter to: Library of the University of Amsterdam, Secretariat, Singel 425, 1012 WP Amsterdam,
The Netherlands. You will be contacted as soon as possible.
Download date: 19 Apr 2017
Chapter 7
CHAPTER 13
Glucosylated cholesterol in mammalian cells
and tissues: formation and degradation by
multiple cellular β-glucosidases
J Lipid Res. 2016 Jan 2. pii: jlr.M064923.
Chapter 7
13
Glucosylated cholesterol in mammalian cells and tissues:
formation and degradation by multiple cellular βglucosidases
André R. A. Marques1,#; Mina Mirzaian2,#; Hisako Akiyama3,#; Patrick Wisse4; Maria J. Ferraz1; Paulo Gaspar1;
Karen Ghauharali-van der Vlugt1; Rianne Meijer2; Pilar Giraldo5; Pilar Alfonso5; Pilar Irún5; Maria Dahl6;
Stefan Karlsson6; Elena V. Pavlova7; Timothy M. Cox7; Saskia Scheij1; Marri Verhoek2; Roelof Ottenhoff1;
Cindy P. A. A. van Roomen1; Navraj S. Pannu2; Marco van Eijk2; Nick Dekker1; Rolf G. Boot2; Herman S.
Overkleeft4; Edward Blommaart1; Yoshio Hirabayashi3; Johannes M. Aerts1,2
1Department of Medical Biochemistry, Academic Medical Center, Amsterdam, The Netherlands; 2Department
of Medical Biochemistry, Leiden Institute of Chemistry, Leiden, The Netherlands; 3Brain Science Institute,
RIKEN, Wako, Japan; 4Department of Bio-organic Synthesis, Leiden Institute of Chemistry, Leiden, The
Netherlands; 5Centro de Investigación Biomédica en Red de Enfermedades Raras, Unidad de Investigación
Traslacional, Zaragoza, Spain; 6Department of Molecular Medicine and Gene Therapy, Lund University, Lund,
Sweden; 7Addenbrooke’s Hospital, Department of Medicine, University of Cambridge, Cambridge, UK, #These
authors contributed equally to this work, and should be considered as first authors.
J Lipid Res. 2016 Jan 2. pii: jlr.M064923
Abstract The membrane lipid glucosylceramide (GlcCer) is continuously formed and degraded. Cells
express two GlcCer-degrading β-glucosidases, GBA and GBA2, located in and outside the lysosome,
respectively. Here we demonstrate that through transglucosylation both GBA and GBA2 are able to
catalyze in vitro the transfer of glucosyl-moieties from GlcCer to cholesterol, and vice versa.
Furthermore, the natural occurrence of 1-O-cholesteryl-β-D-glucopyranoside (GlcChol) in mouse
tissues and human plasma is demonstrated using LC-MS/MS and 13C6-labelled GlcChol as internal
standard. In cells the inhibition of GBA increases GlcChol, whereas inhibition of GBA2 decreases
glucosylated sterol. Similarly, in GBA2-deficient mice GlcChol is reduced. Depletion of GlcCer by
inhibition of GlcCer synthase decreases GlcChol in cells and likewise in plasma of inhibitor-treated
Gaucher disease patients. In tissues of mice with Niemann-Pick type C, a condition characterized by
intralysosomal accumulation of cholesterol, marked elevations in GlcChol occur as well. When
lysosomal accumulation of cholesterol is induced in cultured cells, GlcChol is formed via lysosomal
GBA. This illustrates that reversible transglucosylation reactions are highly dependent on local
availability of suitable acceptors. In conclusion, mammalian tissues contain GlcChol formed by
transglucosylation through β-glucosidases using GlcCer as donor. Our findings reveal a novel
metabolic function for GlcCer.
Keywords cholesterol, glucosyl-β-D-cholesterol, glucosylceramide, glucocerebrosidase, Gaucher
disease, Niemann Pick type C disease.
Ch ap te r 1
3
13
Glucosylated cholesterol in mammalian cells and tissues:
formation and degradation by multiple cellular βglucosidases
André R. A. Marques1,#; Mina Mirzaian2,#; Hisako Akiyama3,#; Patrick Wisse4; Maria J. Ferraz1; Paulo Gaspar1;
Karen Ghauharali-van der Vlugt1; Rianne Meijer2; Pilar Giraldo5; Pilar Alfonso5; Pilar Irún5; Maria Dahl6;
Stefan Karlsson6; Elena V. Pavlova7; Timothy M. Cox7; Saskia Scheij1; Marri Verhoek2; Roelof Ottenhoff1;
Cindy P. A. A. van Roomen1; Navraj S. Pannu2; Marco van Eijk2; Nick Dekker1; Rolf G. Boot2; Herman S.
Overkleeft4; Edward Blommaart1; Yoshio Hirabayashi3; Johannes M. Aerts1,2
1Department of Medical Biochemistry, Academic Medical Center, Amsterdam, The Netherlands; 2Department
of Medical Biochemistry, Leiden Institute of Chemistry, Leiden, The Netherlands; 3Brain Science Institute,
RIKEN, Wako, Japan; 4Department of Bio-organic Synthesis, Leiden Institute of Chemistry, Leiden, The
Netherlands; 5Centro de Investigación Biomédica en Red de Enfermedades Raras, Unidad de Investigación
Traslacional, Zaragoza, Spain; 6Department of Molecular Medicine and Gene Therapy, Lund University, Lund,
Sweden; 7Addenbrooke’s Hospital, Department of Medicine, University of Cambridge, Cambridge, UK, #These
authors contributed equally to this work, and should be considered as first authors.
J Lipid Res. 2016 Jan 2. pii: jlr.M064923
Abstract The membrane lipid glucosylceramide (GlcCer) is continuously formed and degraded. Cells
express two GlcCer-degrading β-glucosidases, GBA and GBA2, located in and outside the lysosome,
respectively. Here we demonstrate that through transglucosylation both GBA and GBA2 are able to
catalyze in vitro the transfer of glucosyl-moieties from GlcCer to cholesterol, and vice versa.
Furthermore, the natural occurrence of 1-O-cholesteryl-β-D-glucopyranoside (GlcChol) in mouse
tissues and human plasma is demonstrated using LC-MS/MS and 13C6-labelled GlcChol as internal
standard. In cells the inhibition of GBA increases GlcChol, whereas inhibition of GBA2 decreases
glucosylated sterol. Similarly, in GBA2-deficient mice GlcChol is reduced. Depletion of GlcCer by
inhibition of GlcCer synthase decreases GlcChol in cells and likewise in plasma of inhibitor-treated
Gaucher disease patients. In tissues of mice with Niemann-Pick type C, a condition characterized by
intralysosomal accumulation of cholesterol, marked elevations in GlcChol occur as well. When
lysosomal accumulation of cholesterol is induced in cultured cells, GlcChol is formed via lysosomal
GBA. This illustrates that reversible transglucosylation reactions are highly dependent on local
availability of suitable acceptors. In conclusion, mammalian tissues contain GlcChol formed by
transglucosylation through β-glucosidases using GlcCer as donor. Our findings reveal a novel
metabolic function for GlcCer.
Keywords cholesterol, glucosyl-β-D-cholesterol, glucosylceramide, glucocerebrosidase, Gaucher
disease, Niemann Pick type C disease.
Glucosylated cholesterol metabolism by β-glucosidases 249
Corresponding author:
Prof. Johannes M. F. G. Aerts
Gorlaeus Laboratories
Einsteinweg 55, 2300 RA Leiden, The Netherlands
Phone: +31 (0) 71 5274771; E-mail: j.m.f.g.aerts@lic.leidenuniv.nl
Running title: Glucosylated cholesterol metabolism by β-glucosidases.
Abbreviations: 25-NBD-cholesterol: 25-[N-[(7-nitro-2-1,3-benzoxadiazol-4-yl) methyl] amino]-27norcholesterol; GlcChol: 1-O-cholesteryl-β-D-glucopyranoside; GlcCer: glucosylceramide; LSD: lysosomal
storage disease; GD: Gaucher disease; NPC: Niemann-Pick type C; GSL: glycosphingolipid.
Introduction
Membranes of higher eukaryotic cells contain glycerolipids, sterols and sphingolipids. For each
of these lipid classes, monoglucosylated structures have been reported. Glucosylceramide (GlcCer),
the intermediate in biosynthesis and degradation of more complex glycosphingolipids (GSLs), is
ubiquitous in mammalian cells, particularly located in the cell membrane (1). Its presence in plants
and some fungi is also documented. Glucosyldiacylglycerol (GlcDG) has been identified in various
plants, but its presence in mammalian cells is comparatively poorly documented (2, 3). Likewise,
sterol-glucosides are known to occur in plants and fungal species (4), but their existence in
mammalian cells has not been extensively studied. Indications of the existence of glucosyl-β-Dcholesterol or 1-O-cholesteryl-β-D-glucopyranoside (GlcChol) in mammalian cells were first
provided by Murofushi and co-workers. They described its occurrence in cultured human fibroblasts
and gastric mucosa (5, 6). Heat shock was found to increase biosynthesis of GlcChol and
subsequently induce HSP70 (7). GlcCer is formed by the enzyme glucosylceramide synthase (GCS,
EC2.4.1.80). This transferase, firstly cloned by Hirabayashi and colleagues (8), is located at the
cytosolic leaflet of Golgi apparatus where it transfers the glucose-moiety from UDP-glucose to
ceramide (9). In a recent study, Akiyama et al. showed that GCS does not synthesize GlcChol (10).
They noticed that GM-95 cells deficient in GCS are unable to synthesize GlcChol without the addition
of exogenous GlcCer. Furthermore, the same researchers demonstrated that, at least in vitro, the
lysosomal enzyme glucocerebrosidase (GBA; E.C.3.2.1.45) generates through transglucosylation 25NBD-cholesterol-glucoside from GlcCer and artificial 25-NBD-cholesterol (11). Such ability of GBA
to perform transglucosylation was earlier demonstrated by Glew and co-workers, showing catalyzed
transfer of the glucose moiety from 4-methylumbelliferyl-β-glucoside to retinol and other alcohols
(12).
The enzyme GBA is well studied since its deficiency underlies Gaucher disease (GD), a
relatively common lysosomal storage disease (LSD) (13). Assisted by the small activator protein
saposin C, GBA degrades GlcCer to ceramide and glucose in lysosomes, the penultimate step in GSL
catabolism (13). Deficient GBA activity in GD patients consequently results in accumulation of
GlcCer in lysosomes, most prominently in macrophages. These “Gaucher cells” secrete specific
proteins as well as glucosylsphingosine (GlcSph), the deacylated form of GlcCer (14–16). The nonneuronopathic (type 1) variant of GD is presently treated by enzyme replacement therapy (ERT),
implying chronic two-weekly intravenous infusion of macrophage-targeted recombinant enzyme (17).
An alternative treatment of type 1 GD, named substrate reduction, is based on oral administration of
an inhibitor of GCS (18–20).
Mammalian cells and tissues contain other β-glucosidases besides GBA that degrade GlcCer.
All cells express the membrane-associated non-lysosomal glucosylceramidase, named GBA2 (21–23).
This enzyme is not deficient in GD patients. In fact, a compensatory overexpression of GBA2 in
materials of GD has been reported (24). GBA2 has been found to be located outside lysosomes, being
noted at the endoplasmic reticulum (ER) in hepatocytes (22), at the ER and Golgi apparatus in
HEK293 cells overexpressing enzyme (25) and at the endosomes in fibroblasts and COS-7 cells (23).
GBA2 degrades GlcCer without need for an activator protein, and further differs from GBA in noted
artificial substrate and inhibitor specificity (21). Finally, some tissues express the enzyme GBA3, also
referred to as broad-specific cytosolic β-glucosidase (26). This enzyme shows a relative poor in vitro
hydrolytic activity towards GlcCer and is thought to be primarily involved in de-toxification of
glucosylated xenobiotics (26). All three human retaining β-glucosidases employ the double
displacement mechanism in catalysis. There are many documented examples of transglucosylation
mediated by retaining glycosidases (27). Therefore, in addition to GBA, theoretically also GBA2 and
GBA3 might generate GlcChol.
Modification of cholesterol by glucosylation changes the physico-chemical properties of the
sterol, rendering it far more water soluble. Given the potential physiological relevance, the natural
occurrence of GlcChol, and its metabolism, in cells and tissues is of interest. We therefore studied the
existence of the glucosylated sterol in mammalian tissues. For this purpose 13C6-isotope labelled
GlcChol was synthesized to be used as internal standard in sensitive quantitative detection of GlcChol
by LC-MS/MS. Here we demonstrate the natural occurrence of GlcChol in mammalian cells and
tissues. Moreover we document the ability of both GBA and GBA2 to degrade as well as synthesize
GlcChol. The importance of substrate and acceptor concentrations regarding the action of GBA and
GBA2 in GlcChol metabolism is experimentally demonstrated. Our investigation demonstrates the
surprising versatility of β-glucosidases, a finding discussed in relation to metabolism of sphingolipids
and sterols in health and disease.
Materials and Methods
Materials 25-[N-[(7-nitro-2-1,3-benzoxadiazol-4-yl)methyl]amino]-27-norcholesterol (25-NBD-Cholesterol),
N-[6-[(7-nitro-2-1,3-benzoxadiazol-4-yl)amino]hexanoyl]-D-glucosyl-β1-1’-sphingosine (C6-NBD-GlcCer), N[6-[(7-nitro-2-1,3-benzoxadiazol-4-yl)amino]hexanoyl]-D-erythro-sphingosine (C6-NBD-Cer), D-glucosyl-ß1,1′ N-palmitoyl-D-erythro-sphingosine (C16:0-GlcCer) and D-glucosyl-β-1,1’N-oleoyl-D-erythro-sphingosine
(C18:1-GlcCer) were purchased from Avanti Polar Lipids (Alabaster, AL, USA). 4-methylumbelliferyl β-Dglucopyranoside (4MU-Glc) was purchased from Glycosynth™ (Winwick Quay Warrington, Cheshire,
England). Conduritol B epoxide (D, L-1,2-anhydro-myo-inositol; CBE) was from Enzo Life Sciences Inc.
(Farmingdale, NY, USA), 1-O-cholesteryl-β-D-glucopyranoside (β-cholesteryl glucoside, β-GlcChol) and
ammonium formate (LC-MS quality) were from Sigma-Aldrich (St Louis, MO, USA). N-(nButyl)deoxygalactonojirimycin (NB-DGJ) was purchased from Toronto Research Chemicals (Toronto, Canada).
GBA2 inhibitor N-(5-adamantane-1-yl-methoxy-pentyl)-deoxynojirimycin (AMP-DNM) and GBA3 inhibitor α1-C-nonyl-DIX (anDIX) were chemically synthesized in the department of Bio-organic Synthesis at the Faculty
of Science, Leiden Institute of Chemistry at the University of Leiden (Leiden, The Netherlands). Cerezyme®, a
recombinant human GBA (rGBA) was obtained from Genzyme (Genzyme Nederland, Naarden, The
Netherlands). Cholesterol trafficking inhibitor U18666A and methyl-β-cyclodextrin were from Sigma-Aldrich
Chemie GmbH. LC-MS–grade methanol, 2-propanol, water, HPLC-grade chloroform were purchased from
Biosolve; ammonium formate LC-MS grade from Sigma-Aldrich Chemie GmbH.
Synthesis of 13C6 isotope labelled β-cholesteryl glucoside (13C6-β-GlcChol) The synthesis of 13C-labelled
glucosyl donor 4 (see Scheme 1) commences with protecting the five hydroxyls in glucose 1 as the benzoyl
Chapter 13250
Ch ap te r 1
3
Corresponding author:
Prof. Johannes M. F. G. Aerts
Gorlaeus Laboratories
Einsteinweg 55, 2300 RA Leiden, The Netherlands
Phone: +31 (0) 71 5274771; E-mail: j.m.f.g.aerts@lic.leidenuniv.nl
Running title: Glucosylated cholesterol metabolism by β-glucosidases.
Abbreviations: 25-NBD-cholesterol: 25-[N-[(7-nitro-2-1,3-benzoxadiazol-4-yl) methyl] amino]-27norcholesterol; GlcChol: 1-O-cholesteryl-β-D-glucopyranoside; GlcCer: glucosylceramide; LSD: lysosomal
storage disease; GD: Gaucher disease; NPC: Niemann-Pick type C; GSL: glycosphingolipid.
Introduction
Membranes of higher eukaryotic cells contain glycerolipids, sterols and sphingolipids. For each
of these lipid classes, monoglucosylated structures have been reported. Glucosylceramide (GlcCer),
the intermediate in biosynthesis and degradation of more complex glycosphingolipids (GSLs), is
ubiquitous in mammalian cells, particularly located in the cell membrane (1). Its presence in plants
and some fungi is also documented. Glucosyldiacylglycerol (GlcDG) has been identified in various
plants, but its presence in mammalian cells is comparatively poorly documented (2, 3). Likewise,
sterol-glucosides are known to occur in plants and fungal species (4), but their existence in
mammalian cells has not been extensively studied. Indications of the existence of glucosyl-β-Dcholesterol or 1-O-cholesteryl-β-D-glucopyranoside (GlcChol) in mammalian cells were first
provided by Murofushi and co-workers. They described its occurrence in cultured human fibroblasts
and gastric mucosa (5, 6). Heat shock was found to increase biosynthesis of GlcChol and
subsequently induce HSP70 (7). GlcCer is formed by the enzyme glucosylceramide synthase (GCS,
EC2.4.1.80). This transferase, firstly cloned by Hirabayashi and colleagues (8), is located at the
cytosolic leaflet of Golgi apparatus where it transfers the glucose-moiety from UDP-glucose to
ceramide (9). In a recent study, Akiyama et al. showed that GCS does not synthesize GlcChol (10).
They noticed that GM-95 cells deficient in GCS are unable to synthesize GlcChol without the addition
of exogenous GlcCer. Furthermore, the same researchers demonstrated that, at least in vitro, the
lysosomal enzyme glucocerebrosidase (GBA; E.C.3.2.1.45) generates through transglucosylation 25NBD-cholesterol-glucoside from GlcCer and artificial 25-NBD-cholesterol (11). Such ability of GBA
to perform transglucosylation was earlier demonstrated by Glew and co-workers, showing catalyzed
transfer of the glucose moiety from 4-methylumbelliferyl-β-glucoside to retinol and other alcohols
(12).
The enzyme GBA is well studied since its deficiency underlies Gaucher disease (GD), a
relatively common lysosomal storage disease (LSD) (13). Assisted by the small activator protein
saposin C, GBA degrades GlcCer to ceramide and glucose in lysosomes, the penultimate step in GSL
catabolism (13). Deficient GBA activity in GD patients consequently results in accumulation of
GlcCer in lysosomes, most prominently in macrophages. These “Gaucher cells” secrete specific
proteins as well as glucosylsphingosine (GlcSph), the deacylated form of GlcCer (14–16). The nonneuronopathic (type 1) variant of GD is presently treated by enzyme replacement therapy (ERT),
implying chronic two-weekly intravenous infusion of macrophage-targeted recombinant enzyme (17).
An alternative treatment of type 1 GD, named substrate reduction, is based on oral administration of
an inhibitor of GCS (18–20).
Mammalian cells and tissues contain other β-glucosidases besides GBA that degrade GlcCer.
All cells express the membrane-associated non-lysosomal glucosylceramidase, named GBA2 (21–23).
This enzyme is not deficient in GD patients. In fact, a compensatory overexpression of GBA2 in
materials of GD has been reported (24). GBA2 has been found to be located outside lysosomes, being
noted at the endoplasmic reticulum (ER) in hepatocytes (22), at the ER and Golgi apparatus in
HEK293 cells overexpressing enzyme (25) and at the endosomes in fibroblasts and COS-7 cells (23).
GBA2 degrades GlcCer without need for an activator protein, and further differs from GBA in noted
artificial substrate and inhibitor specificity (21). Finally, some tissues express the enzyme GBA3, also
referred to as broad-specific cytosolic β-glucosidase (26). This enzyme shows a relative poor in vitro
hydrolytic activity towards GlcCer and is thought to be primarily involved in de-toxification of
glucosylated xenobiotics (26). All three human retaining β-glucosidases employ the double
displacement mechanism in catalysis. There are many documented examples of transglucosylation
mediated by retaining glycosidases (27). Therefore, in addition to GBA, theoretically also GBA2 and
GBA3 might generate GlcChol.
Modification of cholesterol by glucosylation changes the physico-chemical properties of the
sterol, rendering it far more water soluble. Given the potential physiological relevance, the natural
occurrence of GlcChol, and its metabolism, in cells and tissues is of interest. We therefore studied the
existence of the glucosylated sterol in mammalian tissues. For this purpose 13C6-isotope labelled
GlcChol was synthesized to be used as internal standard in sensitive quantitative detection of GlcChol
by LC-MS/MS. Here we demonstrate the natural occurrence of GlcChol in mammalian cells and
tissues. Moreover we document the ability of both GBA and GBA2 to degrade as well as synthesize
GlcChol. The importance of substrate and acceptor concentrations regarding the action of GBA and
GBA2 in GlcChol metabolism is experimentally demonstrated. Our investigation demonstrates the
surprising versatility of β-glucosidases, a finding discussed in relation to metabolism of sphingolipids
and sterols in health and disease.
Materials and Methods
Materials 25-[N-[(7-nitro-2-1,3-benzoxadiazol-4-yl)methyl]amino]-27-norcholesterol (25-NBD-Cholesterol),
N-[6-[(7-nitro-2-1,3-benzoxadiazol-4-yl)amino]hexanoyl]-D-glucosyl-β1-1’-sphingosine (C6-NBD-GlcCer), N[6-[(7-nitro-2-1,3-benzoxadiazol-4-yl)amino]hexanoyl]-D-erythro-sphingosine (C6-NBD-Cer), D-glucosyl-ß1,1′ N-palmitoyl-D-erythro-sphingosine (C16:0-GlcCer) and D-glucosyl-β-1,1’N-oleoyl-D-erythro-sphingosine
(C18:1-GlcCer) were purchased from Avanti Polar Lipids (Alabaster, AL, USA). 4-methylumbelliferyl β-Dglucopyranoside (4MU-Glc) was purchased from Glycosynth™ (Winwick Quay Warrington, Cheshire,
England). Conduritol B epoxide (D, L-1,2-anhydro-myo-inositol; CBE) was from Enzo Life Sciences Inc.
(Farmingdale, NY, USA), 1-O-cholesteryl-β-D-glucopyranoside (β-cholesteryl glucoside, β-GlcChol) and
ammonium formate (LC-MS quality) were from Sigma-Aldrich (St Louis, MO, USA). N-(nButyl)deoxygalactonojirimycin (NB-DGJ) was purchased from Toronto Research Chemicals (Toronto, Canada).
GBA2 inhibitor N-(5-adamantane-1-yl-methoxy-pentyl)-deoxynojirimycin (AMP-DNM) and GBA3 inhibitor α1-C-nonyl-DIX (anDIX) were chemically synthesized in the department of Bio-organic Synthesis at the Faculty
of Science, Leiden Institute of Chemistry at the University of Leiden (Leiden, The Netherlands). Cerezyme®, a
recombinant human GBA (rGBA) was obtained from Genzyme (Genzyme Nederland, Naarden, The
Netherlands). Cholesterol trafficking inhibitor U18666A and methyl-β-cyclodextrin were from Sigma-Aldrich
Chemie GmbH. LC-MS–grade methanol, 2-propanol, water, HPLC-grade chloroform were purchased from
Biosolve; ammonium formate LC-MS grade from Sigma-Aldrich Chemie GmbH.
Synthesis of 13C6 isotope labelled β-cholesteryl glucoside (13C6-β-GlcChol) The synthesis of 13C-labelled
glucosyl donor 4 (see Scheme 1) commences with protecting the five hydroxyls in glucose 1 as the benzoyl
Glucosylated cholesterol metabolism by β-glucosidases 251
esters using pyridine and benzoyl chloride to give 1,2,3,4,6-penta-O-benzoyl-β-D-13C6-glucopyranoside 2
quantitatively. In the next step the anomeric benzoate was selectively removed using hydrazine acetate
providing 2,3,4,6-tetra-O-benzoyl-α/β-D-13C6-glucopyranoside 3 in 82% yield. The anomeric hydroxyl in 3 was
transformed into the corresponding trichloroacetimidate using trichloroacetonitrile and 1,8diazabicyclo[5.4.0]undec-7-ene as base giving 2,3,4,6-tetra-O-benzoyl-1-(2,2,2-trichloroethanimidate)-α-D13C6-glucopyranoside 4. In the penultimate step, cholesterol was reacted with 4 under the agency of a catalytic
amount of trimethylsilylmethanesulphonate (TMSOTf) in dichloromethane at room temperature. After 1 h the
reaction was quenched with triethylamine and the mixture purified by silica gel column chromatography giving
cholesteryl 2,3,4,6-tetra-O-benzoyl-β-D-13C6-glucopyranoside 5 in 83%. Compound 5 was deprotected using
sodium methoxide in methanol/dichloromethane giving after silica gel column chromatography the title
compound, cholesteryl-β-D-13C6-glucopyranoside (13C6-GlcChol) 6 as a white solid in 94%.
Scheme 1. Synthesis of cholesteryl-β-D-13C6-glucopyranoside (13C6-GlcChol) 6 (28).
Animal Studies Npc1-/- mice (Npc1nih and Npc1spm), along with wild-type (wt) littermates (Npc1+/+), were
generated by crossing Npc1+/- males and females in-house. The heterozygous BALB/c Nctr-Npc1m1N/J mice
(stock number 003092) and heterozygous C57BLKS/J-Npc1spm/J (stock number 002760) were obtained from the
Jackson Laboratory (Bar Harbor, USA). Mouse pups were genotyped according to published protocols (29, 30).
The Gba2-/- mice (C57Bl/6-129S6/SvEv mixed background) were generated as previously described (22).
Breeding pairs of LIMP-2 were kindly provided by Prof. Paul Saftig (Kiel, Germany) (31). Homozygous WT
animals (LIMP2+/+) and homozygous animals (LIMP2-/-) were generated by crossing heterozygous (LIMP2+/-)
mice. Genotyping was determined by PCR using genomic DNA (31). Mice (± 3 weeks old) received the rodent
AM-II diet (Arie Blok Diervoeders, Woerden, The Netherlands). The mice were housed at the Institute Animal
Core Facility in a temperature- and humidity-controlled room with a 12-h light/dark cycle and given access to
food and water ad libitum. All animal protocols were approved by the Institutional Animal Welfare Committee
of the Academic Medical Centre Amsterdam in the Netherlands (DBC101698, DBC100757-115, DBC100757125 and DBC17AC)
The generation of the GD1 mouse model has been described previously (32, 33). Mice were maintained
in individually ventilated cages with ad libitum food and water in the animal facility at Lund University
Biomedical Center. Breeding and experimental procedures were approved by the Committee for Animal Ethics
in Malmö/Lund, Sweden.
Animals were first anesthetized with a dose of Hypnorm (0.315 mg/mL phenyl citrate and 10 mg/mL
fluanisone) and Dormicum (5 mg/mL midazolam) according to their weight. The given dose was 80 µL/10 g
bodyweight. Animals were sacrificed by cervical dislocation. Organs were collected by surgery, rinsed with
PBS, directly snap-frozen in liquid nitrogen and stored at -80 °C. Later, homogenates were made from the
frozen material in 25 mM potassium phosphate buffer pH 6.5, supplemented with 0.1% (v/v) Triton X-100 and
protease inhibitors (4 µL of buffer per mg of tissue).
O
OH
HO
HO
OH
OH
BzCl, pyridine
rt, on, 100%
O
OBz
BzO
BzO
BzO
OBz
O
OBz
BzO
BzO
BzO
OH
H2NNH2HOAc,
DMF, rt, on, 82%
CCl3CN, DBU
rt, 3 h, 72%
O
OBz
BzO
BzO
BzO
O
NH
CCl3
cat. TMSOTf,
DCM, rt, 1 h,83%O
H
H
HH
O
OBz
BzO
BzO
BzO
O
H
H
HHO
OH
HO
HO
HO
NaOMe,
MeOH/DCM
rt, 1 h, 94%
1 2 3
456
Cloning of cDNAs encoding GBA2, GBA3 and UGCG The design of cloning primers was based on NCBI
reference sequences NM_172692.3 for murine GBA2, NM_020973.3 for human hGBA3 and NM_003358.2 for
human UGCG (GCS). Using the primers listed below, the full-length coding sequences were cloned into
pcDNA3.1/Myc-His (Invitrogen, Life Technologies, Carlsbad, CA, USA), using primers: RB143:
GAATTCGCCGCCACCATGGTAACCTGCGTCCCGG and RB144:
GCGGCCGCTCTGAATTGAGGTTTGCCAG for mGBA2; RB252:
GAATTCGCCGCCACCATGGCTTTCCCTGCAGGATTTG and RB253:
GCGGCCGCTACAGATGTGCTTCAAGGCC for hGBA3; RB111: TCCTGCGGGAGCGTTGTC and RB114:
GGTACCTACATCTAGGATTTCCTCTGC for hUCGC. These constructs were used to transfect COS-7 cells.
For the transfection of chinese hamster ovary cells (CHO-K1 cells) full-length coding sequence for
transcript variant 1 of human GBA3 (NM_020973.3) was cloned into p3xFLAG-CMV-14 (Sigma-Aldrich, St.
Louis, MO, USA) as described previously (11).
Cell culture and transfection RAW264.7 cells were obtained from the “American Type Culture Collection”
and were cultured in DMEM (Dulbecco’s Modified Eagle Medium; Life Technologies, Carlsbad, CA, USA)
supplemented with 10% fetal bovine serum (FBS; Bodinco, Alkmaar, The Netherlands) with
penicillin/streptomycin (Life Technologies, Carlsbad, CA, USA). COS-7 cells were cultured in Iscove’s
modified Dulbecco’s medium with 5% FBS and penicillin/streptomycin under 5% CO2 at 37ºC. Cells were
seeded at 75% confluence in 6-well plates and transfected using FuGENE® 6 Transfection Reagent (Promega
Benelux, Leiden, The Netherlands) according to the manufacturer’s instructions, at a FuGENE:DNA ratio of
3:1. After 24 h, inhibitors of GBA (CBE, 300 µM) or GBA2 (AMP-DNM, 20 nM) were added and 48 h later,
the medium was removed, cells were washed trice with ice-cold PBS and harvested by scraping in 25 mM
potassium-phosphate buffer pH 6.5. CHO-K1 cells (RCB0285, established by Puck, T. T.) were purchased from
RIKEN BioResource Center (Ibaraki, Japan) and cultured in Ham's F-12 medium (Nissui) supplemented with
10% FBS under 5% CO2 at 37°C. cDNA transfection for CHO-K1 cells was carried out using Lipofectamine®
2000 Transfection Reagent (Life Technologies, Carlsbad, CA, USA) according to the manufacturer’s
instructions. After 24 h, medium containing transfection reagents was removed, and cells were incubated with
lysis buffer [50 mM Tris-HCl, 150 mM NaCl, 1 mM EDTA, 1% Triton X-100, 1 tablet/10 mL Complete
Protease Inhibitor Cocktail Tablets (Roche, Basel, Switzerland), pH 7.4] for 15-30 min at 4°C after washing
with PBS. The cells were harvested and centrifuged at 12,000xg for 10 min at 4°C. The obtained supernatants
were collected for in vitro enzyme assays.
In vitro assay of transglucosylase activity Lysates of COS-7 cells overexpressing GBA2, GBA3, GCS, and
rGBA were used to determine transglucosylase activity of each enzyme. The assay was performed as described
earlier (11) with a few modifications. First, 40 µL of homogenate of cells overexpressing GBA2, GBA3 or GCS
was pre-incubated with 10 µL of 25 mM CBE in water for 20 min (samples containing diluted rGBA were preincubated in the absence of CBE). To each of the samples 200 µL of the appropriate buffer containing 100 µM
of donor (either C18:1-GlcCer or GlcChol) and 40 µM of acceptor (either 25-NBD-Cholesterol or C6-NBDCer), was added. Transglucosylase activity of GBA2 overexpressing cells was measured in a 150 mM McIlvaine
buffer pH 5.8 and the assay for rGBA was done in a 150 mM McIlvaine buffer pH 5.2 containing 0.1% BSA,
0.1% Triton X-100 and 0.2% sodium taurocholate. For GBA3 the assay contained 100 mM HEPES buffer, pH
7.0. The transglucosylase assay for GCS was performed in a 125 mM potassium-phosphate buffer pH 7.5 with
12.5 mM UDP-glucose, 6.25 mM MgCl2, 0.125% BSA, and 0.625% CHAPS. After 1 h of incubation at 37ºC,
the reaction was terminated by addition of chloroform/methanol (1:1, v/v) and lipids were extracted according to
Bligh and Dyer (34). Thereafter lipids were separated by TLC on HPTLC silica gel 60 plates (Merck,
Darmstadt, Germany) using chloroform/methanol (85:15, v/v) as eluent followed by detection of NBD-labelled
lipids using a Typhoon Variable Mode Imager (GE Healthcare Bio-Science Corp., Piscataway, NJ, USA) (35).
Identification of newly formed fluorescent lipid in transglucosylation assays with 25-NBD cholesterol as
acceptor was performed following its isolation by scraping from plates by demonstration of complete digestion
to NBD-cholesterol using excess rGBA at pH 5.2 (McIlvaine buffer) in the presence of 0.2% (w/v) sodium
taurocholate and 0.1 % (v/v) Triton X-100.
Chapter 13252
Ch ap te r 1
3
esters using pyridine and benzoyl chloride to give 1,2,3,4,6-penta-O-benzoyl-β-D-13C6-glucopyranoside 2
quantitatively. In the next step the anomeric benzoate was selectively removed using hydrazine acetate
providing 2,3,4,6-tetra-O-benzoyl-α/β-D-13C6-glucopyranoside 3 in 82% yield. The anomeric hydroxyl in 3 was
transformed into the corresponding trichloroacetimidate using trichloroacetonitrile and 1,8diazabicyclo[5.4.0]undec-7-ene as base giving 2,3,4,6-tetra-O-benzoyl-1-(2,2,2-trichloroethanimidate)-α-D13C6-glucopyranoside 4. In the penultimate step, cholesterol was reacted with 4 under the agency of a catalytic
amount of trimethylsilylmethanesulphonate (TMSOTf) in dichloromethane at room temperature. After 1 h the
reaction was quenched with triethylamine and the mixture purified by silica gel column chromatography giving
cholesteryl 2,3,4,6-tetra-O-benzoyl-β-D-13C6-glucopyranoside 5 in 83%. Compound 5 was deprotected using
sodium methoxide in methanol/dichloromethane giving after silica gel column chromatography the title
compound, cholesteryl-β-D-13C6-glucopyranoside (13C6-GlcChol) 6 as a white solid in 94%.
Scheme 1. Synthesis of cholesteryl-β-D-13C6-glucopyranoside (13C6-GlcChol) 6 (28).
Animal Studies Npc1-/- mice (Npc1nih and Npc1spm), along with wild-type (wt) littermates (Npc1+/+), were
generated by crossing Npc1+/- males and females in-house. The heterozygous BALB/c Nctr-Npc1m1N/J mice
(stock number 003092) and heterozygous C57BLKS/J-Npc1spm/J (stock number 002760) were obtained from the
Jackson Laboratory (Bar Harbor, USA). Mouse pups were genotyped according to published protocols (29, 30).
The Gba2-/- mice (C57Bl/6-129S6/SvEv mixed background) were generated as previously described (22).
Breeding pairs of LIMP-2 were kindly provided by Prof. Paul Saftig (Kiel, Germany) (31). Homozygous WT
animals (LIMP2+/+) and homozygous animals (LIMP2-/-) were generated by crossing heterozygous (LIMP2+/-)
mice. Genotyping was determined by PCR using genomic DNA (31). Mice (± 3 weeks old) received the rodent
AM-II diet (Arie Blok Diervoeders, Woerden, The Netherlands). The mice were housed at the Institute Animal
Core Facility in a temperature- and humidity-controlled room with a 12-h light/dark cycle and given access to
food and water ad libitum. All animal protocols were approved by the Institutional Animal Welfare Committee
of the Academic Medical Centre Amsterdam in the Netherlands (DBC101698, DBC100757-115, DBC100757125 and DBC17AC)
The generation of the GD1 mouse model has been described previously (32, 33). Mice were maintained
in individually ventilated cages with ad libitum food and water in the animal facility at Lund University
Biomedical Center. Breeding and experimental procedures were approved by the Committee for Animal Ethics
in Malmö/Lund, Sweden.
Animals were first anesthetized with a dose of Hypnorm (0.315 mg/mL phenyl citrate and 10 mg/mL
fluanisone) and Dormicum (5 mg/mL midazolam) according to their weight. The given dose was 80 µL/10 g
bodyweight. Animals were sacrificed by cervical dislocation. Organs were collected by surgery, rinsed with
PBS, directly snap-frozen in liquid nitrogen and stored at -80 °C. Later, homogenates were made from the
frozen material in 25 mM potassium phosphate buffer pH 6.5, supplemented with 0.1% (v/v) Triton X-100 and
protease inhibitors (4 µL of buffer per mg of tissue).
O
OH
HO
HO
OH
OH
BzCl, pyridine
rt, on, 100%
O
OBz
BzO
BzO
BzO
OBz
O
OBz
BzO
BzO
BzO
OH
H2NNH2HOAc,
DMF, rt, on, 82%
CCl3CN, DBU
rt, 3 h, 72%
O
OBz
BzO
BzO
BzO
O
NH
CCl3
cat. TMSOTf,
DCM, rt, 1 h,83%O
H
H
HH
O
OBz
BzO
BzO
BzO
O
H
H
HHO
OH
HO
HO
HO
NaOMe,
MeOH/DCM
rt, 1 h, 94%
1 2 3
456
Cloning of cDNAs encoding GBA2, GBA3 and UGCG The design of cloning primers was based on NCBI
reference sequences NM_172692.3 for murine GBA2, NM_020973.3 for human hGBA3 and NM_003358.2 for
human UGCG (GCS). Using the primers listed below, the full-length coding sequences were cloned into
pcDNA3.1/Myc-His (Invitrogen, Life Technologies, Carlsbad, CA, USA), using primers: RB143:
GAATTCGCCGCCACCATGGTAACCTGCGTCCCGG and RB144:
GCGGCCGCTCTGAATTGAGGTTTGCCAG for mGBA2; RB252:
GAATTCGCCGCCACCATGGCTTTCCCTGCAGGATTTG and RB253:
GCGGCCGCTACAGATGTGCTTCAAGGCC for hGBA3; RB111: TCCTGCGGGAGCGTTGTC and RB114:
GGTACCTACATCTAGGATTTCCTCTGC for hUCGC. These constructs were used to transfect COS-7 cells.
For the transfection of chinese hamster ovary cells (CHO-K1 cells) full-length coding sequence for
transcript variant 1 of human GBA3 (NM_020973.3) was cloned into p3xFLAG-CMV-14 (Sigma-Aldrich, St.
Louis, MO, USA) as described previously (11).
Cell culture and transfection RAW264.7 cells were obtained from the “American Type Culture Collection”
and were cultured in DMEM (Dulbecco’s Modified Eagle Medium; Life Technologies, Carlsbad, CA, USA)
supplemented with 10% fetal bovine serum (FBS; Bodinco, Alkmaar, The Netherlands) with
penicillin/streptomycin (Life Technologies, Carlsbad, CA, USA). COS-7 cells were cultured in Iscove’s
modified Dulbecco’s medium with 5% FBS and penicillin/streptomycin under 5% CO2 at 37ºC. Cells were
seeded at 75% confluence in 6-well plates and transfected using FuGENE® 6 Transfection Reagent (Promega
Benelux, Leiden, The Netherlands) according to the manufacturer’s instructions, at a FuGENE:DNA ratio of
3:1. After 24 h, inhibitors of GBA (CBE, 300 µM) or GBA2 (AMP-DNM, 20 nM) were added and 48 h later,
the medium was removed, cells were washed trice with ice-cold PBS and harvested by scraping in 25 mM
potassium-phosphate buffer pH 6.5. CHO-K1 cells (RCB0285, established by Puck, T. T.) were purchased from
RIKEN BioResource Center (Ibaraki, Japan) and cultured in Ham's F-12 medium (Nissui) supplemented with
10% FBS under 5% CO2 at 37°C. cDNA transfection for CHO-K1 cells was carried out using Lipofectamine®
2000 Transfection Reagent (Life Technologies, Carlsbad, CA, USA) according to the manufacturer’s
instructions. After 24 h, medium containing transfection reagents was removed, and cells were incubated with
lysis buffer [50 mM Tris-HCl, 150 mM NaCl, 1 mM EDTA, 1% Triton X-100, 1 tablet/10 mL Complete
Protease Inhibitor Cocktail Tablets (Roche, Basel, Switzerland), pH 7.4] for 15-30 min at 4°C after washing
with PBS. The cells were harvested and centrifuged at 12,000xg for 10 min at 4°C. The obtained supernatants
were collected for in vitro enzyme assays.
In vitro assay of transglucosylase activity Lysates of COS-7 cells overexpressing GBA2, GBA3, GCS, and
rGBA were used to determine transglucosylase activity of each enzyme. The assay was performed as described
earlier (11) with a few modifications. First, 40 µL of homogenate of cells overexpressing GBA2, GBA3 or GCS
was pre-incubated with 10 µL of 25 mM CBE in water for 20 min (samples containing diluted rGBA were preincubated in the absence of CBE). To each of the samples 200 µL of the appropriate buffer containing 100 µM
of donor (either C18:1-GlcCer or GlcChol) and 40 µM of acceptor (either 25-NBD-Cholesterol or C6-NBDCer), was added. Transglucosylase activity of GBA2 overexpressing cells was measured in a 150 mM McIlvaine
buffer pH 5.8 and the assay for rGBA was done in a 150 mM McIlvaine buffer pH 5.2 containing 0.1% BSA,
0.1% Triton X-100 and 0.2% sodium taurocholate. For GBA3 the assay contained 100 mM HEPES buffer, pH
7.0. The transglucosylase assay for GCS was performed in a 125 mM potassium-phosphate buffer pH 7.5 with
12.5 mM UDP-glucose, 6.25 mM MgCl2, 0.125% BSA, and 0.625% CHAPS. After 1 h of incubation at 37ºC,
the reaction was terminated by addition of chloroform/methanol (1:1, v/v) and lipids were extracted according to
Bligh and Dyer (34). Thereafter lipids were separated by TLC on HPTLC silica gel 60 plates (Merck,
Darmstadt, Germany) using chloroform/methanol (85:15, v/v) as eluent followed by detection of NBD-labelled
lipids using a Typhoon Variable Mode Imager (GE Healthcare Bio-Science Corp., Piscataway, NJ, USA) (35).
Identification of newly formed fluorescent lipid in transglucosylation assays with 25-NBD cholesterol as
acceptor was performed following its isolation by scraping from plates by demonstration of complete digestion
to NBD-cholesterol using excess rGBA at pH 5.2 (McIlvaine buffer) in the presence of 0.2% (w/v) sodium
taurocholate and 0.1 % (v/v) Triton X-100.
Glucosylated cholesterol metabolism by β-glucosidases 253
Lysates of CHO-K1 cells were used to access the transglucosylase activity and the β-glucosidase activity
of GBA3. The assay for transglucosylase activity was performed according to the method we established
previously (11) with slight modifications. The reaction mixture in a total volume of 20 μL contained 40 μM 25NBD-cholesterol, 80 µM C16:0-GlcCer, 50 mM citrate-phosphate buffer, pH 6.2, 0.5% CHAPS, 2% ethanol,
and desired amount of enzyme. After incubation at 37°C for 20 h, the reaction was terminated by adding
chloroform/methanol (2:1, v/v), and the lipids were extracted and analyzed as reported before (11). The assay
for β-glucosidase activity was performed according to the method we established previously (11) with slight
modifications. The reaction mixture in a total volume of 20 μL contained 100 pmol C6-NBD-GlcCer, 50 mM
citrate-phosphate buffer, pH 6.2, and a desired amount of enzyme. After incubation at 37°C for 30 min, the
reaction was terminated by adding chloroform/methanol (2:1, v/v), and the lipids were extracted and analyzed as
reported before (11).
Analysis of GlcChol by LC-MS/MS A Waters AcquityTM TQD instrument was used in all experiments. The
instrument consisted of a UPLC system combined with a tandem quadruple mass spectrometer as mass analyzer.
Data were analyzed with Masslynx 4.1 Software (Waters Corporation; Milford MA). GlcChol and 13C6-GlcChol
(internal standard) were separated using a BEH C18 reversed-phase column (2.1x 50 mm, particle size 1.7 µm;
Waters), by applying an isocratic elution of mobile phases, 2-propanol:H2O 90:10 (v/v) containing 10 mM
ammonium formate (Eluent A) and methanol containing 10 mM ammonium formate (Eluent B). The ULPC
program was applied during 5.0 minutes consisting of 10% A and 90% B. The divert valve of the mass
spectrometer was programmed to discard the UPLC effluent before (0 to 0.25 min) and after (4 to 5 min) the
elution of the analytes to prevent system contamination. The flow rate was 0.250 mL/min and the retention time
of both GlcChol and the internal standard was 1.43 min (Figure 1C). The column temperature and the
temperature of the autosampler were kept at 23°C and 10°C respectively during the run.
Solutions of GlcChol and 13C6-GlcChol and a mixture of both compounds were prepared with
concentrations of 1 pmol/µL in 5 mM ammonium formate in methanol. The compounds were introduced in the
mass spectrometer by direct infusion and the optimal tuning conditions for both compounds in ES+ (electrospray
positive) mode were determined (Table 1). The most abundant species for both compounds were ammonium
adducts, [M+NH4]+, m/z 566.6>369.4 for GlcChol and m/z 572.6>369.4 for 13C6-GlcChol (see also Figure 1B).
The product ion represents the cholesterol part of the molecule after loss of the glucose moiety. Because the 13C
isotopes are on the glucose molecule, the daughter fragment of 13C6-GlcChol has the same m/z ratio of 369.4.
Confirmation of compounds with m/z 566.6>369.4 being GlcChol was performed by demonstration of
complete digestion to cholesterol using excess rGBA at pH 5.2 (McIlvaine buffer). The release of glucose was
confirmed by a glucose oxidase assay.
Table 1. MS/MS instrument parameters.
Capillary voltage 3.50 KV
Cone voltage 20 V
Source temperature 120 °C
Desolvation temperature 450 °C
Cone gas 50 L/h
Desolvation gas 950 L/h
Collision gas 0.20 mL/min
Collision voltage 20 V
Type Multiple reaction monitoring
Ion mode ES+ (electrospray positive)
Dwell time 0.250 s
Interchannel delay 0.005 s
Interscan delay 0.005 s
Transitions: RT(min.):
GlcChol 1.43
13C6-GlcChol 1.43
Fit weight None
Smooth method Mean
Smooth width 2
RT, retention time
Collection of NPC and GD patient plasma EDTA plasma (15 males and 3 females) were collected prior to
therapy from Dutch patients suffering from type 1 GD, known by referral to the Academic Medical Center.
Diagnosis of GD in patients was confirmed by genotyping and demonstration of deficient glucocerebrosidase
activity in leukocytes or fibroblasts. Plasma samples were stored frozen at 20C until further use. EDTA
plasma samples of 42 male and 47 female control subjects were collected at the Academic Medical Center. The
EDTA plasma samples of 15 NPC patients and 9 NPC carriers were collected at the Unidad de Investigación
Traslacional in Zaragoza, Spain.
The status of affected or carrier of NPC disease was determined after the exomic sequencing of NPC1
and NPC2 genes, according to the presence of two or one mutations, respectively. Filipin stainings of fibroblats
were conducted to complete the diagnosis study. Plasma samples were stored frozen at -20 ° C until further use.
Approval had been obtained from the institutional ethics committee and informed consent according to the
Declaration of Helsinki.
Quantification of total GlcChol in human plasma For quantitative analysis of GlcChol in samples of plasma,
we developed a LC-MS/MS method using the MRM (multiple reaction monitoring) mode of the transitions
mentioned above. Firstly, GlcChol was extracted from plasma from a healthy individual according the method
of Bligh and Dyer (34) with a few modifications. 20 µL of plasma was pipetted in an Eppendorf tube (2 mL)
and 20 µL of an internal standard solution, containing 0.1 pmol/µL of 13C6-GlcChol in methanol, was added,
followed by addition of 280 µL methanol and 150 μL of chloroform. After brief mixing, the sample was left at
room temperature for 30 min, mixed occasionally and centrifuged for 10 min at 15,700xg to spin down
precipitated protein. The supernatant was transferred to an Eppendorf tube and 150 μL chloroform and 250 µL
water were added to induce separation of phases. After centrifugation (5 min at 15,700xg) the lower,
hydrophobic phase was transferred to a clean Eppendorf tube and the upper phase was washed by addition of
300 μL of chloroform. Lower phases were pooled and taken to dryness at 35°C under a nitrogen stream. Next,
the residue was dissolved in 700 μL of butanol and 700 μL of water, mixed well and centrifuged for 10 min at
15,700xg. The upper phase (butanol) was transferred to a 1 mL tube with screw cap and the sample was dried
under a gentle stream of nitrogen at 35°C. Subsequently, the residue was dissolved in 150 μL of eluent B by
mixing and sonication and after centrifugation (5 min at 15,700xg) an aliquot of 100 μL was transferred into an
UPLC vial with insert. 10 µL of the solution was injected for analysis.
Secondly, for the quantification of GlcChol in plasma, the sample was spiked with GlcChol
(concentrations: 0-2.5-5-10-50-100-200-1000 pmol GlcChol/mL of plasma), internal standard was added and
samples were extracted. The ratio, the area from transition GlcChol over the area from the transition 13C6GlcChol, was plotted against the concentration of GlcChol spiked in the plasma samples. A linear response was
obtained over the entire concentration range (y =0.0108x+1.9188, R2 = 0.998). The within run variation (164.2 ±
4.3 pmol/mL with CV [coefficient of variation] % 2.6) and between run variation (166.8 ± 3.6 pmol/mL with
CV% 2.2), was determined in plasma of a healthy volunteer by ten repetitive measurements.
The limit of detection (LOD) was 0.5 pmol/mL plasma with a signal to noise ratio of three and the limit
of quantitation (LOQ) was 0.9 pmol/mL plasma with a signal to noise ratio of 10. Calculation of the signal to
noise ratio was done using the peak-to-peak method.
Analysis of GlcChol in animal tissues by LC-MS/MS 3 pmol of 13C6-labelled GlcChol in methanol was added
to 30 µL of mouse tissue homogenate. Next, lipids were extracted according to the method of Bligh and Dyer
(34) and GlcChol was analyzed by LC-MS as described above.
Analysis of GlcChol in COS-7 cells by LC-MS/MS COS-7 cells overexpressing GBA2 or GCS were
homogenized by sonication on ice. Prior to extraction, 2 pmol of 13C6-labelled GlcChol in methanol (used as an
internal standard) was added to 180 µL of homogenate. Next, lipids were extracted according to the method of
Bligh and Dyer (34) by addition of methanol, chloroform and water (1:1:0.9, v/v/v) and the lower phase was
taken to dryness under a stream of nitrogen. Isolated lipids were purified by water/butanol extraction (1:1, v/v)
and GlcChol was analyzed by LC-MS as described above.
Chapter 13254
Ch ap te r 1
3
Lysates of CHO-K1 cells were used to access the transglucosylase activity and the β-glucosidase activity
of GBA3. The assay for transglucosylase activity was performed according to the method we established
previously (11) with slight modifications. The reaction mixture in a total volume of 20 μL contained 40 μM 25NBD-cholesterol, 80 µM C16:0-GlcCer, 50 mM citrate-phosphate buffer, pH 6.2, 0.5% CHAPS, 2% ethanol,
and desired amount of enzyme. After incubation at 37°C for 20 h, the reaction was terminated by adding
chloroform/methanol (2:1, v/v), and the lipids were extracted and analyzed as reported before (11). The assay
for β-glucosidase activity was performed according to the method we established previously (11) with slight
modifications. The reaction mixture in a total volume of 20 μL contained 100 pmol C6-NBD-GlcCer, 50 mM
citrate-phosphate buffer, pH 6.2, and a desired amount of enzyme. After incubation at 37°C for 30 min, the
reaction was terminated by adding chloroform/methanol (2:1, v/v), and the lipids were extracted and analyzed as
reported before (11).
Analysis of GlcChol by LC-MS/MS A Waters AcquityTM TQD instrument was used in all experiments. The
instrument consisted of a UPLC system combined with a tandem quadruple mass spectrometer as mass analyzer.
Data were analyzed with Masslynx 4.1 Software (Waters Corporation; Milford MA). GlcChol and 13C6-GlcChol
(internal standard) were separated using a BEH C18 reversed-phase column (2.1x 50 mm, particle size 1.7 µm;
Waters), by applying an isocratic elution of mobile phases, 2-propanol:H2O 90:10 (v/v) containing 10 mM
ammonium formate (Eluent A) and methanol containing 10 mM ammonium formate (Eluent B). The ULPC
program was applied during 5.0 minutes consisting of 10% A and 90% B. The divert valve of the mass
spectrometer was programmed to discard the UPLC effluent before (0 to 0.25 min) and after (4 to 5 min) the
elution of the analytes to prevent system contamination. The flow rate was 0.250 mL/min and the retention time
of both GlcChol and the internal standard was 1.43 min (Figure 1C). The column temperature and the
temperature of the autosampler were kept at 23°C and 10°C respectively during the run.
Solutions of GlcChol and 13C6-GlcChol and a mixture of both compounds were prepared with
concentrations of 1 pmol/µL in 5 mM ammonium formate in methanol. The compounds were introduced in the
mass spectrometer by direct infusion and the optimal tuning conditions for both compounds in ES+ (electrospray
positive) mode were determined (Table 1). The most abundant species for both compounds were ammonium
adducts, [M+NH4]+, m/z 566.6>369.4 for GlcChol and m/z 572.6>369.4 for 13C6-GlcChol (see also Figure 1B).
The product ion represents the cholesterol part of the molecule after loss of the glucose moiety. Because the 13C
isotopes are on the glucose molecule, the daughter fragment of 13C6-GlcChol has the same m/z ratio of 369.4.
Confirmation of compounds with m/z 566.6>369.4 being GlcChol was performed by demonstration of
complete digestion to cholesterol using excess rGBA at pH 5.2 (McIlvaine buffer). The release of glucose was
confirmed by a glucose oxidase assay.
Table 1. MS/MS instrument parameters.
Capillary voltage 3.50 KV
Cone voltage 20 V
Source temperature 120 °C
Desolvation temperature 450 °C
Cone gas 50 L/h
Desolvation gas 950 L/h
Collision gas 0.20 mL/min
Collision voltage 20 V
Type Multiple reaction monitoring
Ion mode ES+ (electrospray positive)
Dwell time 0.250 s
Interchannel delay 0.005 s
Interscan delay 0.005 s
Transitions: RT(min.):
GlcChol 1.43
13C6-GlcChol 1.43
Fit weight None
Smooth method Mean
Smooth width 2
RT, retention time
Collection of NPC and GD patient plasma EDTA plasma (15 males and 3 females) were collected prior to
therapy from Dutch patients suffering from type 1 GD, known by referral to the Academic Medical Center.
Diagnosis of GD in patients was confirmed by genotyping and demonstration of deficient glucocerebrosidase
activity in leukocytes or fibroblasts. Plasma samples were stored frozen at 20C until further use. EDTA
plasma samples of 42 male and 47 female control subjects were collected at the Academic Medical Center. The
EDTA plasma samples of 15 NPC patients and 9 NPC carriers were collected at the Unidad de Investigación
Traslacional in Zaragoza, Spain.
The status of affected or carrier of NPC disease was determined after the exomic sequencing of NPC1
and NPC2 genes, according to the presence of two or one mutations, respectively. Filipin stainings of fibroblats
were conducted to complete the diagnosis study. Plasma samples were stored frozen at -20 ° C until further use.
Approval had been obtained from the institutional ethics committee and informed consent according to the
Declaration of Helsinki.
Quantification of total GlcChol in human plasma For quantitative analysis of GlcChol in samples of plasma,
we developed a LC-MS/MS method using the MRM (multiple reaction monitoring) mode of the transitions
mentioned above. Firstly, GlcChol was extracted from plasma from a healthy individual according the method
of Bligh and Dyer (34) with a few modifications. 20 µL of plasma was pipetted in an Eppendorf tube (2 mL)
and 20 µL of an internal standard solution, containing 0.1 pmol/µL of 13C6-GlcChol in methanol, was added,
followed by addition of 280 µL methanol and 150 μL of chloroform. After brief mixing, the sample was left at
room temperature for 30 min, mixed occasionally and centrifuged for 10 min at 15,700xg to spin down
precipitated protein. The supernatant was transferred to an Eppendorf tube and 150 μL chloroform and 250 µL
water were added to induce separation of phases. After centrifugation (5 min at 15,700xg) the lower,
hydrophobic phase was transferred to a clean Eppendorf tube and the upper phase was washed by addition of
300 μL of chloroform. Lower phases were pooled and taken to dryness at 35°C under a nitrogen stream. Next,
the residue was dissolved in 700 μL of butanol and 700 μL of water, mixed well and centrifuged for 10 min at
15,700xg. The upper phase (butanol) was transferred to a 1 mL tube with screw cap and the sample was dried
under a gentle stream of nitrogen at 35°C. Subsequently, the residue was dissolved in 150 μL of eluent B by
mixing and sonication and after centrifugation (5 min at 15,700xg) an aliquot of 100 μL was transferred into an
UPLC vial with insert. 10 µL of the solution was injected for analysis.
Secondly, for the quantification of GlcChol in plasma, the sample was spiked with GlcChol
(concentrations: 0-2.5-5-10-50-100-200-1000 pmol GlcChol/mL of plasma), internal standard was added and
samples were extracted. The ratio, the area from transition GlcChol over the area from the transition 13C6GlcChol, was plotted against the concentration of GlcChol spiked in the plasma samples. A linear response was
obtained over the entire concentration range (y =0.0108x+1.9188, R2 = 0.998). The within run variation (164.2 ±
4.3 pmol/mL with CV [coefficient of variation] % 2.6) and between run variation (166.8 ± 3.6 pmol/mL with
CV% 2.2), was determined in plasma of a healthy volunteer by ten repetitive measurements.
The limit of detection (LOD) was 0.5 pmol/mL plasma with a signal to noise ratio of three and the limit
of quantitation (LOQ) was 0.9 pmol/mL plasma with a signal to noise ratio of 10. Calculation of the signal to
noise ratio was done using the peak-to-peak method.
Analysis of GlcChol in animal tissues by LC-MS/MS 3 pmol of 13C6-labelled GlcChol in methanol was added
to 30 µL of mouse tissue homogenate. Next, lipids were extracted according to the method of Bligh and Dyer
(34) and GlcChol was analyzed by LC-MS as described above.
Analysis of GlcChol in COS-7 cells by LC-MS/MS COS-7 cells overexpressing GBA2 or GCS were
homogenized by sonication on ice. Prior to extraction, 2 pmol of 13C6-labelled GlcChol in methanol (used as an
internal standard) was added to 180 µL of homogenate. Next, lipids were extracted according to the method of
Bligh and Dyer (34) by addition of methanol, chloroform and water (1:1:0.9, v/v/v) and the lower phase was
taken to dryness under a stream of nitrogen. Isolated lipids were purified by water/butanol extraction (1:1, v/v)
and GlcChol was analyzed by LC-MS as described above.
Glucosylated cholesterol metabolism by β-glucosidases 255
Analysis of GlcCer and ceramide (Cer) in COS-7 cells by HPLC COS-7 cells overexpressing GBA2 or GCS,
were homogenized by sonication on ice. Prior to extraction, 1 nmol of C17-sphinganine in methanol (used as an
internal standard) was added to 100 µL of homogenate. Next, lipids were extracted according to the method of
Bligh and Dyer (34) by addition of methanol, chloroform and water (1:1:0.9, v/v/v) and the lower phase taken to
dryness under a stream of nitrogen. Isolated lipids were deacylated in a microwave oven, derivatized and
analyzed by HPLC as described before (36).
Analysis of GlcChol in RAW264.7 cells by LC-MS/MS 3 pmol of 13C6-labelled GlcChol in methanol was
added to 100 µL of RAW264.7 cell lysate. Next, lipids were extracted according to the method of Bligh and
Dyer (34) and GlcChol was analyzed by LC-MS as described above.
Protein concentration Determined using the Pierce BCA Protein Assay kit (Thermo Scientific) by the
microplate procedure. Absorbance measured in EL808 Ultra Microplate Reader (BIO-TEK Instruments Inc.) at
550nm.
Statistical Analysis Values in figures are presented as a mean ± S.D. Data were analyzed by unpaired Student’s
t-test or Mann-Whitney U test. P values < 0.05 were considered significant. * P < 0.05, ** P < 0.01 and *** P <
0.001.
Results
Quantification of GlcChol by LC-MS/MS
To establish whether glucosyl-β-D-cholesterol (GlcChol) physiologically occurs in mammals, we
firstly developed a LC-MS/MS procedure for its quantitative detection. For this purpose, a 13C6isotope labelled GlcChol was synthesized (13C6-GlcChol). The use of the isotope labelled compound
as internal standard avoids the need for corrections for extraction efficiency, chromatographic
behavior and ionization efficiency, during quantification of GlcChol. To prevent undesired adduct
formation, lipids were extracted in the absence of additional salts. To stimulate formation of desired
ammonium adduct we incorporated 10 mM ammonium in the eluent.
Sensitive quantitative measurement of GlcChol proved feasible with 13C6-isotope labelled
GlcChol as internal standard as shown in Figure 1A-C. The limit of detection (LOD) was 0.5
pmol/mL plasma, with a signal to noise ratio of 3 and a limit of quantitation (LOQ) of 0.9 pmol/mL
plasma with a signal to noise ratio of 10. GlcChol was found to be an excellent substrate for
recombinant GBA (rGBA Cerezyme®), even at sub-optimal conditions (absence of Triton X-100 and
sodium taurocholate) (Figure 1D).
Figure 1. Quantification of GlcChol by LC-MS/MS. A. MS-scan of pure GlcChol and its 13C-labelled isotope.
The ammonium-adduct is the most abundant M/Z for both compounds. The product ion M/Z 369.4 is the
common fragment for both compounds. Shown are the parent scans of product ion 369.4 of GlcChol and 13C6labelled GlcChol, [M+NH4]+, 566.6 for GlcChol and 572.6 for 13C6-GlcChol. The [M+H]+ and [M+Na]+ are the
minor M/Z. a: M/Z 571.6 represents the sodium adduct of GlcChol. B. The structure of GlcChol and its isotope
13C6-labelled GlcChol, their fragmentation pattern M/Z 369.4 is the product ion of both compounds after loss of
glucose moiety. C. Elution pattern of GlcChol (M/Z 566.6>369.4) and 13C6-labelled GlcChol (M/Z
572.6>369.4) from UPLC. D. Linearity of GlcChol quantification and its complete digestion with rGBA (1.0
U/mL) for 18 h at 37°C.
Demonstration of natural occurrence of GlcChol in mice
Next, we examined various tissues of wild-type (wt) mice on the presence of GlcChol. Relative high
amounts of glucosylated sterol were noted for thymus, sciatic nerve, brain and lungs (see Figure 2A).
The identity of the quantified structure (m/z 566.6) in thymus (and other tissues) was confirmed by its
digestion by rGBA, showing that in wt animals more than 90% of the lipid measured is indeed
glucosyl-β-D-cholesterol. However, in sciatic nerve and brain a significant proportion of m/z 566.6
was not digested by rGBA, suggesting that it may represent another glycosylated cholesterol, for
example galactosyl-β-D-cholesterol.
The concentration of GlcChol in liver and thymus was determined for tissues of wt mice,
animals lacking GBA2 (22) and LIMP-2 KO mice with markedly reduced GBA due to impaired
transport to lysosomes (31). As shown in Figure 2B, C and D, the GlcChol concentration was
markedly lower in all the tissues of GBA2-deficient animals analyzed compared to wt controls,
especially in thymus. In contrast, in the GBA-deficient LIMP-2 KO mice no reduction in GlcChol, but
Chapter 13256
Ch ap te r 1
3
Analysis of GlcCer and ceramide (Cer) in COS-7 cells by HPLC COS-7 cells overexpressing GBA2 or GCS,
were homogenized by sonication on ice. Prior to extraction, 1 nmol of C17-sphinganine in methanol (used as an
internal standard) was added to 100 µL of homogenate. Next, lipids were extracted according to the method of
Bligh and Dyer (34) by addition of methanol, chloroform and water (1:1:0.9, v/v/v) and the lower phase taken to
dryness under a stream of nitrogen. Isolated lipids were deacylated in a microwave oven, derivatized and
analyzed by HPLC as described before (36).
Analysis of GlcChol in RAW264.7 cells by LC-MS/MS 3 pmol of 13C6-labelled GlcChol in methanol was
added to 100 µL of RAW264.7 cell lysate. Next, lipids were extracted according to the method of Bligh and
Dyer (34) and GlcChol was analyzed by LC-MS as described above.
Protein concentration Determined using the Pierce BCA Protein Assay kit (Thermo Scientific) by the
microplate procedure. Absorbance measured in EL808 Ultra Microplate Reader (BIO-TEK Instruments Inc.) at
550nm.
Statistical Analysis Values in figures are presented as a mean ± S.D. Data were analyzed by unpaired Student’s
t-test or Mann-Whitney U test. P values < 0.05 were considered significant. * P < 0.05, ** P < 0.01 and *** P <
0.001.
Results
Quantification of GlcChol by LC-MS/MS
To establish whether glucosyl-β-D-cholesterol (GlcChol) physiologically occurs in mammals, we
firstly developed a LC-MS/MS procedure for its quantitative detection. For this purpose, a 13C6isotope labelled GlcChol was synthesized (13C6-GlcChol). The use of the isotope labelled compound
as internal standard avoids the need for corrections for extraction efficiency, chromatographic
behavior and ionization efficiency, during quantification of GlcChol. To prevent undesired adduct
formation, lipids were extracted in the absence of additional salts. To stimulate formation of desired
ammonium adduct we incorporated 10 mM ammonium in the eluent.
Sensitive quantitative measurement of GlcChol proved feasible with 13C6-isotope labelled
GlcChol as internal standard as shown in Figure 1A-C. The limit of detection (LOD) was 0.5
pmol/mL plasma, with a signal to noise ratio of 3 and a limit of quantitation (LOQ) of 0.9 pmol/mL
plasma with a signal to noise ratio of 10. GlcChol was found to be an excellent substrate for
recombinant GBA (rGBA Cerezyme®), even at sub-optimal conditions (absence of Triton X-100 and
sodium taurocholate) (Figure 1D).
Figure 1. Quantification of GlcChol by LC-MS/MS. A. MS-scan of pure GlcChol and its 13C-labelled isotope.
The ammonium-adduct is the most abundant M/Z for both compounds. The product ion M/Z 369.4 is the
common fragment for both compounds. Shown are the parent scans of product ion 369.4 of GlcChol and 13C6labelled GlcChol, [M+NH4]+, 566.6 for GlcChol and 572.6 for 13C6-GlcChol. The [M+H]+ and [M+Na]+ are the
minor M/Z. a: M/Z 571.6 represents the sodium adduct of GlcChol. B. The structure of GlcChol and its isotope
13C6-labelled GlcChol, their fragmentation pattern M/Z 369.4 is the product ion of both compounds after loss of
glucose moiety. C. Elution pattern of GlcChol (M/Z 566.6>369.4) and 13C6-labelled GlcChol (M/Z
572.6>369.4) from UPLC. D. Linearity of GlcChol quantification and its complete digestion with rGBA (1.0
U/mL) for 18 h at 37°C.
Demonstration of natural occurrence of GlcChol in mice
Next, we examined various tissues of wild-type (wt) mice on the presence of GlcChol. Relative high
amounts of glucosylated sterol were noted for thymus, sciatic nerve, brain and lungs (see Figure 2A).
The identity of the quantified structure (m/z 566.6) in thymus (and other tissues) was confirmed by its
digestion by rGBA, showing that in wt animals more than 90% of the lipid measured is indeed
glucosyl-β-D-cholesterol. However, in sciatic nerve and brain a significant proportion of m/z 566.6
was not digested by rGBA, suggesting that it may represent another glycosylated cholesterol, for
example galactosyl-β-D-cholesterol.
The concentration of GlcChol in liver and thymus was determined for tissues of wt mice,
animals lacking GBA2 (22) and LIMP-2 KO mice with markedly reduced GBA due to impaired
transport to lysosomes (31). As shown in Figure 2B, C and D, the GlcChol concentration was
markedly lower in all the tissues of GBA2-deficient animals analyzed compared to wt controls,
especially in thymus. In contrast, in the GBA-deficient LIMP-2 KO mice no reduction in GlcChol, but
Glucosylated cholesterol metabolism by β-glucosidases 257
rather a significant increase in liver and plasma levels was observed (Figure 2C and D; P < 0.001 and
P < 0.05, respectively). Mice with an induced GBA deficiency in the white blood cell lineage showed
upon treatment with glucosylceramide synthase (GCS) inhibitor Genz-112638 (Eliglustat tartrate,
Genzyme) partial reduction in plasma GlcCer (37) and an almost statistically significant reduction of
elevated plasma GlcChol (Figure 2E, P = 0.07). An increase in GlcChol was also observed in liver
(Figure 2F, P < 0.001), spleen and bone marrow (see Supplemental Figure 1) of mice with induced
Gaucher disease. Correction of GBA deficiency by lentiviral gene therapy under the control of
different promoters led in all cases to a concomitant reduction of GlcChol in these tissues (Figure 2F).
Figure 2. GlcChol in tissues of wt, GBA-deficient and GBA2-deficient mice. A. GlcChol (picomoles per
milligram protein) in various tissues of wt male mice at 2 months of age (n = 3, mean ± S.D.). *Significant
proportion of m/z 566.6 was not digestible by rGBA. B. GlcChol (nanomoles per gram wet weight) in thymus of
wt, Gba2-/- and Limp2-/- male mice at 2 months of age (n = 3, mean ± S.D.). C. GlcChol (nanomoles per gram
wet weight) in liver of wt, Gba2-/- and Limp2-/- male mice at 2 months of age (n = 3, mean ± S.D.). D. GlcChol
(nanomolar) in plasma of wt, Gba2-/- and Limp2-/- male mice at 2 months of age (n = 3, mean ± S.D.). E. Plasma
GlcChol (nanomolar) in wt (n = 27), type 1 GD mice untreated (n = 40) and treated with Genz-112638 (n = 27)
(mean ± S.D.). F. Liver GlcChol (nanomoles per gram wet weight) in wt mice (n = 6, mean ± S.D.), type 1 GD
induced mice untreated (n = 6), type 1 GD treated with lentiviral GBA cDNA gene therapy with macrophage
specific promotor (CD68) (n = 8), ubiquitously expressed human phosphoglycerate kinase (PGK) promotor (n =
12) or gammaretroviral vector with the viral promoter spleen focus forming virus (SFFV) promotor (n = 8).
Data were analyzed using an unpaired t-test. * P < 0.05, ** P < 0.01 and *** P < 0.001.
In vitro transglycosylation by β-glucosidases
The enzymes GBA and GBA2 were both found able to hydrolyze GlcChol at conditions optimal for
degradation of 4-methylumbelliferyl-β-D-glucopyranoside (4MU-Glc) (Supplemental Table 1).
The findings on GlcChol levels in wt, GBA-deficient and GBA2-deficient mice prompted us to
study the ability of the three β-glucosidases GBA, GBA2 and GBA3 to generate glucosylated
cholesterol by transglucosylation. We first studied this ability in vitro and reproduced the assay of
Akiyama and co-workers (11) using 25-NBD-cholesterol as acceptor and detection of 25-NBDglucosyl-cholesterol formation by TLC and fluorescence scanning. As source of enzyme we used
rGBA and individually overexpressed GBA2, GBA3 and GCS in COS-7 cells. Overexpression of
enzymes was checked by measuring enzymatic activity with appropriate assays (not shown).
Recombinant enzyme and COS-7 cell lysates were incubated with natural GlcCer (C18:1GlcCer) as donor and 25-NBD-cholesterol as acceptor. Following incubation at optimal conditions for
each enzyme with inclusion of UDP-Glc for GCS (see Methods section), lipids were extracted and
subjected to HPTLC. As shown in Figure 3A, rGBA and cell lysates with overexpressed GBA2
generated an additional fluorescent lipid coinciding with 25-NBD-cholesterol-glucoside (Figure 3A).
Inhibition of GBA with conduritol B epoxide (CBE) or GBA2 with AMP-DNM prevented formation
of 25-NBD-cholesterol-glucoside (Figure 3A). Transglucosylation was hardly observed for cell
lysates with overexpressed GBA3 and GCS (Figure 3A), recapitulating the findings by Akiyama and
co-workers concerning GCS (10). We repeated the experiment using natural cholesterol as acceptor
and determined the levels of formed GlcChol by LC-MS (Figure 3B). Again, GlcChol formation
occurred in the presence of GBA (inhibitable by CBE) and in cell lysates with high GBA2 (inhibitable
by AMP-DNM) (Figure 3B). Lysates of cells overexpressing GBA3 and GCS showed no additional
GlcChol formation (Supplemental Figure 2). The pH optimum of GBA and GBA2 to generate
GlcChol was next determined (see Supplemental Figure 3). In the case of GBA optimal activity was
seen between pH 4.5-5.5 and for GBA2 between pH 6.0-7.0. We investigated with the same assay
whether GlcSph, GalCer and GalSph also act as glycose donors in the transglycosylation catalyzed by
GBA or GBA2 (see Supplemental Figure 3). This was not observed.
We next studied whether natural GlcChol (100 µM) can also act as donor in transglucosylation
by incubating rGBA and lysates of cells overexpressing GBA2 or GBA3 in the presence of NBDceramide (40 µM) as acceptor. Lysates of cells overexpressing GBA2 and rGBA showed formation of
fluorescent NBD-GlcCer (Figure 3C). This was not observed for lysates with overexpressed GBA3
(Figure 3C). Transglucosylation by both GBA and GBA2 occurs as an equilibrium reaction in which
the glucose moiety is reversibly exchanged between cholesterol and ceramide.
We investigated in more detail potential transglucosylase activity of human GBA3
overexpressed in CHO-K1 cells. Overexpression of GBA3 increased β-glucosidase activity (Figure
3D). As shown in Figure 3E, overexpression of GBA3 did not affect transglucosylase activity from
natural GlcCer (C16:0-GlcCer) to 25-NBD-cholesterol despite the long reaction time (20 h). Almost
same results were observed in cell lysates incubated with natural GlcCer (C18:0-GlcCer or C24:1GlcCer) as donor (data not shown).
Molecular docking of GlcChol in the GBA crystal structure was performed (see Supplemental
Figure 4). The ligand GlcChol was built and regularized with ligand and superimposed on the bicyclic
nojirimycin analogue ligand that was crystallized in complex with GBA (pdb [protein data bank] code
2XWE) using the program coot (see Supplemental Methods). GlcChol was found to be positioned
such that the glucosidic bond is accessible to the catalytic residues Glu235 and Glu340. The
cholesterol moiety concomitantly interacts with aromatic side chains.
Chapter 13258
Ch ap te r 1
3
rather a significant increase in liver and plasma levels was observed (Figure 2C and D; P < 0.001 and
P < 0.05, respectively). Mice with an induced GBA deficiency in the white blood cell lineage showed
upon treatment with glucosylceramide synthase (GCS) inhibitor Genz-112638 (Eliglustat tartrate,
Genzyme) partial reduction in plasma GlcCer (37) and an almost statistically significant reduction of
elevated plasma GlcChol (Figure 2E, P = 0.07). An increase in GlcChol was also observed in liver
(Figure 2F, P < 0.001), spleen and bone marrow (see Supplemental Figure 1) of mice with induced
Gaucher disease. Correction of GBA deficiency by lentiviral gene therapy under the control of
different promoters led in all cases to a concomitant reduction of GlcChol in these tissues (Figure 2F).
Figure 2. GlcChol in tissues of wt, GBA-deficient and GBA2-deficient mice. A. GlcChol (picomoles per
milligram protein) in various tissues of wt male mice at 2 months of age (n = 3, mean ± S.D.). *Significant
proportion of m/z 566.6 was not digestible by rGBA. B. GlcChol (nanomoles per gram wet weight) in thymus of
wt, Gba2-/- and Limp2-/- male mice at 2 months of age (n = 3, mean ± S.D.). C. GlcChol (nanomoles per gram
wet weight) in liver of wt, Gba2-/- and Limp2-/- male mice at 2 months of age (n = 3, mean ± S.D.). D. GlcChol
(nanomolar) in plasma of wt, Gba2-/- and Limp2-/- male mice at 2 months of age (n = 3, mean ± S.D.). E. Plasma
GlcChol (nanomolar) in wt (n = 27), type 1 GD mice untreated (n = 40) and treated with Genz-112638 (n = 27)
(mean ± S.D.). F. Liver GlcChol (nanomoles per gram wet weight) in wt mice (n = 6, mean ± S.D.), type 1 GD
induced mice untreated (n = 6), type 1 GD treated with lentiviral GBA cDNA gene therapy with macrophage
specific promotor (CD68) (n = 8), ubiquitously expressed human phosphoglycerate kinase (PGK) promotor (n =
12) or gammaretroviral vector with the viral promoter spleen focus forming virus (SFFV) promotor (n = 8).
Data were analyzed using an unpaired t-test. * P < 0.05, ** P < 0.01 and *** P < 0.001.
In vitro transglycosylation by β-glucosidases
The enzymes GBA and GBA2 were both found able to hydrolyze GlcChol at conditions optimal for
degradation of 4-methylumbelliferyl-β-D-glucopyranoside (4MU-Glc) (Supplemental Table 1).
The findings on GlcChol levels in wt, GBA-deficient and GBA2-deficient mice prompted us to
study the ability of the three β-glucosidases GBA, GBA2 and GBA3 to generate glucosylated
cholesterol by transglucosylation. We first studied this ability in vitro and reproduced the assay of
Akiyama and co-workers (11) using 25-NBD-cholesterol as acceptor and detection of 25-NBDglucosyl-cholesterol formation by TLC and fluorescence scanning. As source of enzyme we used
rGBA and individually overexpressed GBA2, GBA3 and GCS in COS-7 cells. Overexpression of
enzymes was checked by measuring enzymatic activity with appropriate assays (not shown).
Recombinant enzyme and COS-7 cell lysates were incubated with natural GlcCer (C18:1GlcCer) as donor and 25-NBD-cholesterol as acceptor. Following incubation at optimal conditions for
each enzyme with inclusion of UDP-Glc for GCS (see Methods section), lipids were extracted and
subjected to HPTLC. As shown in Figure 3A, rGBA and cell lysates with overexpressed GBA2
generated an additional fluorescent lipid coinciding with 25-NBD-cholesterol-glucoside (Figure 3A).
Inhibition of GBA with conduritol B epoxide (CBE) or GBA2 with AMP-DNM prevented formation
of 25-NBD-cholesterol-glucoside (Figure 3A). Transglucosylation was hardly observed for cell
lysates with overexpressed GBA3 and GCS (Figure 3A), recapitulating the findings by Akiyama and
co-workers concerning GCS (10). We repeated the experiment using natural cholesterol as acceptor
and determined the levels of formed GlcChol by LC-MS (Figure 3B). Again, GlcChol formation
occurred in the presence of GBA (inhibitable by CBE) and in cell lysates with high GBA2 (inhibitable
by AMP-DNM) (Figure 3B). Lysates of cells overexpressing GBA3 and GCS showed no additional
GlcChol formation (Supplemental Figure 2). The pH optimum of GBA and GBA2 to generate
GlcChol was next determined (see Supplemental Figure 3). In the case of GBA optimal activity was
seen between pH 4.5-5.5 and for GBA2 between pH 6.0-7.0. We investigated with the same assay
whether GlcSph, GalCer and GalSph also act as glycose donors in the transglycosylation catalyzed by
GBA or GBA2 (see Supplemental Figure 3). This was not observed.
We next studied whether natural GlcChol (100 µM) can also act as donor in transglucosylation
by incubating rGBA and lysates of cells overexpressing GBA2 or GBA3 in the presence of NBDceramide (40 µM) as acceptor. Lysates of cells overexpressing GBA2 and rGBA showed formation of
fluorescent NBD-GlcCer (Figure 3C). This was not observed for lysates with overexpressed GBA3
(Figure 3C). Transglucosylation by both GBA and GBA2 occurs as an equilibrium reaction in which
the glucose moiety is reversibly exchanged between cholesterol and ceramide.
We investigated in more detail potential transglucosylase activity of human GBA3
overexpressed in CHO-K1 cells. Overexpression of GBA3 increased β-glucosidase activity (Figure
3D). As shown in Figure 3E, overexpression of GBA3 did not affect transglucosylase activity from
natural GlcCer (C16:0-GlcCer) to 25-NBD-cholesterol despite the long reaction time (20 h). Almost
same results were observed in cell lysates incubated with natural GlcCer (C18:0-GlcCer or C24:1GlcCer) as donor (data not shown).
Molecular docking of GlcChol in the GBA crystal structure was performed (see Supplemental
Figure 4). The ligand GlcChol was built and regularized with ligand and superimposed on the bicyclic
nojirimycin analogue ligand that was crystallized in complex with GBA (pdb [protein data bank] code
2XWE) using the program coot (see Supplemental Methods). GlcChol was found to be positioned
such that the glucosidic bond is accessible to the catalytic residues Glu235 and Glu340. The
cholesterol moiety concomitantly interacts with aromatic side chains.
Glucosylated cholesterol metabolism by β-glucosidases 259
Figure 3. In vitro transglucosylation of 25-NBD GlcChol by GBA and GBA2. A: rGBA and lysates of cells
with overexpression of GBA2, GBA3 and GCS were incubated for 0 and 1 h with 25-NBD-cholesterol in the
presence of C18:1-GlcCer as donor, and in the absence or presence of the respective specific β-glucosidase
inhibitors: CBE (GBA), AMP-DNM (GBA2) and anDIX (GBA3) (26). Formation of 25-NBD-GlcChol was
detected by HPTLC and fluorescence scanning. B: rGBA (in absence or presence of CBE) and lysates of cells
with overexpression of GBA2 (in presence of CBE and in absence or presence of AMP-DNM) were incubated
for 0 and 1 h with cholesterol in the presence of C18:1-GlcCer as donor. Formation of GlcChol was detected by
LC-MS. The percentage of inhibition of GlcChol formation by the respective inhibitors is shown. Data
presented as mean ± S.D.. C: rGBA and lysates of cells with overexpression of GBA2 and GBA3 were
incubated for 0 and 1 h with GlcChol in the presence of NBD-Cer. Formation of NBD-GlcCer was detected by
HPTLC and fluorescence scanning. D: β-glucosidase activity in lysates of CHO-K1 cells overexpressing GBA3.
The activity was measured in the absence or presence of the specific β-glucosidase inhibitors: 0.5 mM CBE
and/or 0.3 mM NB-DGJ. CBE and NB-DGJ sensitive activities were defined as activities derived from GBA
(black box) and GBA2 (gray box), respectively. CBE and NB-DGJ insensitive activity was defined as activity
derived from GBA3 (dotted box). Mock represent the cells transfected with empty vector. E: Transglucosylase
activity in lysates of cells with overexpression of GBA3. Data (n = 3, mean ± S.D.) were analyzed using an
unpaired t-test. * P < 0.05 and ** P < 0.01. Black, gray and dotted lines showed the significant difference of the
activity derived from GBA, GBA2 and GBA3, respectively.
Metabolism of GlcChol in cultured COS-7 cells
Next we studied factors influencing the formation of GlcChol content in cultured green monkey
kidney COS-7 cells. We firstly studied the impact of overexpressed GBA2 and GCS. Figure 4 shows
the effect on cellular GlcChol and GlcCer levels. Only overexpression of GCS led to increased levels
of GlcCer (Figure 4A). GlcChol was not changed by overexpression of GBA2, but overexpression of
GCS caused a twelve-fold increase in this lipid. Importantly, inhibition of GBA2 activity with low
nanomolar AMP-DNM (38) resulted in reduced cellular GlcChol. Even in cells with overexpressed
GCS the elevation in GlcChol was prevented (Figure 4B). In contrast, inhibition of GBA with CBE
hardly diminished increased GlcChol level in cells with overexpressed GCS. These findings suggest
that GCS does not generate GlcChol itself, but is required to generate sufficient GlcCer to be used as
donor in formation of GlcChol by transglucosylation. This transglucosylation in COS-7 cells is
particularly mediated by GBA2, and not GBA. The latter notion is consistent with the finding that
GBA2 deficiency in mice, and not that of GBA, is accompanied with reduced GlcChol levels of
tissues.
Figure 4. GlcChol in COS-7 cells manipulated in GSL metabolizing enzymes. A: GlcCer (nanomoles per
milligram protein) in COS-7 cells without overexpression of enzymes (control), overexpressed GBA2 and GCS.
Cells were incubated for 2 days with indicated inhibitors of GBA2 (AMP-DNM) and GBA (CBE). B: GlcChol
(picomoles per milligram protein) in same cells. Data (n = 4, mean ± S.D.) were analyzed using an unpaired ttest. *** P < 0.001.
GlcChol in Niemann-Pick disease type C mice and U18666A treated cells
In Niemann Pick disease type C (NPC) disease, cholesterol accumulates prominently in lysosomes as
the result of impaired export from the compartment due to defects in either Npc1 or Npc2. In liver of
spontaneous Npc1nih/nih (29, 39, 40) and Npc1spm/spm mice (30, 41) we observed a remarkable, 25-fold,
increase in GlcChol content (Figure 5A and B). The identity of the measured glucosylated sterol was
examined by digestion with rGBA. While more than 90% of the GlcChol in liver of wt mice was
digested to cholesterol, in the case of material from NPC mice this was only around 70% (not shown).
Based on this finding, it seems likely that part of the elevated compound with m/z 566.6>369.4 in
NPC liver consists of cholesterol molecules modified differently with sugar, indistinguishable from
glucosyl-β-D-cholesterol with the LC-MS method.
Chapter 13260
Ch ap te r 1
3
Figure 3. In vitro transglucosylation of 25-NBD GlcChol by GBA and GBA2. A: rGBA and lysates of cells
with overexpression of GBA2, GBA3 and GCS were incubated for 0 and 1 h with 25-NBD-cholesterol in the
presence of C18:1-GlcCer as donor, and in the absence or presence of the respective specific β-glucosidase
inhibitors: CBE (GBA), AMP-DNM (GBA2) and anDIX (GBA3) (26). Formation of 25-NBD-GlcChol was
detected by HPTLC and fluorescence scanning. B: rGBA (in absence or presence of CBE) and lysates of cells
with overexpression of GBA2 (in presence of CBE and in absence or presence of AMP-DNM) were incubated
for 0 and 1 h with cholesterol in the presence of C18:1-GlcCer as donor. Formation of GlcChol was detected by
LC-MS. The percentage of inhibition of GlcChol formation by the respective inhibitors is shown. Data
presented as mean ± S.D.. C: rGBA and lysates of cells with overexpression of GBA2 and GBA3 were
incubated for 0 and 1 h with GlcChol in the presence of NBD-Cer. Formation of NBD-GlcCer was detected by
HPTLC and fluorescence scanning. D: β-glucosidase activity in lysates of CHO-K1 cells overexpressing GBA3.
The activity was measured in the absence or presence of the specific β-glucosidase inhibitors: 0.5 mM CBE
and/or 0.3 mM NB-DGJ. CBE and NB-DGJ sensitive activities were defined as activities derived from GBA
(black box) and GBA2 (gray box), respectively. CBE and NB-DGJ insensitive activity was defined as activity
derived from GBA3 (dotted box). Mock represent the cells transfected with empty vector. E: Transglucosylase
activity in lysates of cells with overexpression of GBA3. Data (n = 3, mean ± S.D.) were analyzed using an
unpaired t-test. * P < 0.05 and ** P < 0.01. Black, gray and dotted lines showed the significant difference of the
activity derived from GBA, GBA2 and GBA3, respectively.
Metabolism of GlcChol in cultured COS-7 cells
Next we studied factors influencing the formation of GlcChol content in cultured green monkey
kidney COS-7 cells. We firstly studied the impact of overexpressed GBA2 and GCS. Figure 4 shows
the effect on cellular GlcChol and GlcCer levels. Only overexpression of GCS led to increased levels
of GlcCer (Figure 4A). GlcChol was not changed by overexpression of GBA2, but overexpression of
GCS caused a twelve-fold increase in this lipid. Importantly, inhibition of GBA2 activity with low
nanomolar AMP-DNM (38) resulted in reduced cellular GlcChol. Even in cells with overexpressed
GCS the elevation in GlcChol was prevented (Figure 4B). In contrast, inhibition of GBA with CBE
hardly diminished increased GlcChol level in cells with overexpressed GCS. These findings suggest
that GCS does not generate GlcChol itself, but is required to generate sufficient GlcCer to be used as
donor in formation of GlcChol by transglucosylation. This transglucosylation in COS-7 cells is
particularly mediated by GBA2, and not GBA. The latter notion is consistent with the finding that
GBA2 deficiency in mice, and not that of GBA, is accompanied with reduced GlcChol levels of
tissues.
Figure 4. GlcChol in COS-7 cells manipulated in GSL metabolizing enzymes. A: GlcCer (nanomoles per
milligram protein) in COS-7 cells without overexpression of enzymes (control), overexpressed GBA2 and GCS.
Cells were incubated for 2 days with indicated inhibitors of GBA2 (AMP-DNM) and GBA (CBE). B: GlcChol
(picomoles per milligram protein) in same cells. Data (n = 4, mean ± S.D.) were analyzed using an unpaired ttest. *** P < 0.001.
GlcChol in Niemann-Pick disease type C mice and U18666A treated cells
In Niemann Pick disease type C (NPC) disease, cholesterol accumulates prominently in lysosomes as
the result of impaired export from the compartment due to defects in either Npc1 or Npc2. In liver of
spontaneous Npc1nih/nih (29, 39, 40) and Npc1spm/spm mice (30, 41) we observed a remarkable, 25-fold,
increase in GlcChol content (Figure 5A and B). The identity of the measured glucosylated sterol was
examined by digestion with rGBA. While more than 90% of the GlcChol in liver of wt mice was
digested to cholesterol, in the case of material from NPC mice this was only around 70% (not shown).
Based on this finding, it seems likely that part of the elevated compound with m/z 566.6>369.4 in
NPC liver consists of cholesterol molecules modified differently with sugar, indistinguishable from
glucosyl-β-D-cholesterol with the LC-MS method.
Glucosylated cholesterol metabolism by β-glucosidases 261
To experimentally substantiate the observations made for GlcChol in liver of NPC mice, we
induced impaired cholesterol export from lysosomes in murine macrophage RAW264.7 cells by
exposure to U18666A (42). Following lysosomal cholesterol accumulation, cells showed elevated
GlcChol. Concomitant inhibition of lysosomal GBA by CBE prevented the increase of GlcChol in
U18666A exposed cells (Figure 5C). Formation of excessive GlcChol was also prevented by the
presence of 1 mM β-methyl-cyclodextrin, an agent known to reduce intralysosomal cholesterol in
NPC cells (43). This indicates that during extreme intralysosomal accumulation of cholesterol, GBA
actively generates GlcChol. In normal lysosomes GBA most likely largely degrades the glucosylated
sterol.
Figure 5. GlcChol abnormalities in NPC. A: GlcChol (nanomoles per gram wet weight) in liver of BALB/c
Npc1+/+, Npc1+/nih and Npc1nih/nih male mice at 80 days of age (n = 3, mean ± S.D.) B: GlcChol (nanomoles per
gram wet weight) in liver of C57BLKS Npc1+/spm and Npc1spm/spm male mice at 80 days of age (n = 3-5, mean ±
S.D.). C: GlcChol (picomoles per milligram protein) in RAW264.7 cells incubated with indicated concentration
U18666A for 1 day in absence and presence of CBE inhibiting GBA (n = 3 mean ± S.D.). D: GlcChol
(picomoles per milligram protein) in RAW264.7 cells incubated with 10 µM U18666A for 8 h and in
subsequent absence or presence of 1 mM β-methyl-cyclodextrin (β-mCD) reducing intralysosomal cholesterol
for 18 h (n = 3 mean ± S.D.). Data were analyzed using an unpaired t-test. ** P < 0.01 and *** P < 0.001.
GlcChol in NPC and GD patients
Finally, we determined GlcChol levels in plasma of untreated symptomatic type 1 GD patients as well
as in NPC patients, carriers and healthy controls. As shown in Figure 6A, GlcChol tends to be
increased in plasma of symptomatic GD patients and less prominently in that of NPC patients. The
abnormalities in GD patients are more pronounced when plasma GlcChol is related to cholesterol
(Chol, Figure 6B). Investigation of plasma specimens of type 1 GD patients treated with GCS
inhibitor Eliglustat (Figure 6C), showed a prominent reduction upon inhibition of GSL synthesis.
Treatment of matched patients with the weaker GCS inhibitor Miglustat (Zavesca®, Actelion) also led
to a reduction of GlcChol, albeit slower (Figure 6C). Of note, treatment of matched patients with
rGBA Cerezyme (enzyme replacement therapy; ERT) did not reduce GlcChol to the same extent,
despite impressive clinical improvements in these patients (Figure 6C) (B.E. Smid et al. unpublished).
Figure 6. Plasma GlcChol in LSD patients and healthy individuals. A: Plasma GlcChol (nanomolar) in
healthy individuals, type 1 GD patients, NPC carriers and NPC patients. B: Ratio of GlcChol/cholesterol (Chol)
in plasma of healthy individuals, type 1 GD patients, NPC carriers and NPC patients. C: Percentage reduction in
plasma GlcChol of matched type 1 GD patients following Eliglustat, Miglustat and ERT treatment compared to
pre-treatment values. Data were analyzed using the Mann-Whitney U test. ** P < 0.01 and *** P < 0.001.
Discussion
Recently, Akiyama and colleagues (11) demonstrated that GBA, either pure recombinant protein or
enzyme in fibroblast lysates, can generate GlcChol by transglucosylation of cholesterol when
provided with GlcCer as donor. The physiological significance of glucosylation of cholesterol is
hypothetically great since it renders a molecule far more water soluble. To establish the natural
occurrence of GlcChol in mammals, we first needed to develop a quantitative and sensitive assay for
quantification of GlcChol in plasma, cells and tissues. The method developed by us makes use of
newly synthesized 13C6-GlcChol as internal standard. Regarding extraction efficiency,
chromatographic behavior and ionization characteristics, the natural and isotope labelled compounds
are identical, so no correction for the sample matrix (ion suppression or ion enhancement) is required.
With sensitive quantification of GlcChol in place, we next observed that almost all tissues of
mice show GlcChol. The relative high amount of the glucosylated sterol in the thymus, several
Chapter 13262
Ch ap te r 1
3
To experimentally substantiate the observations made for GlcChol in liver of NPC mice, we
induced impaired cholesterol export from lysosomes in murine macrophage RAW264.7 cells by
exposure to U18666A (42). Following lysosomal cholesterol accumulation, cells showed elevated
GlcChol. Concomitant inhibition of lysosomal GBA by CBE prevented the increase of GlcChol in
U18666A exposed cells (Figure 5C). Formation of excessive GlcChol was also prevented by the
presence of 1 mM β-methyl-cyclodextrin, an agent known to reduce intralysosomal cholesterol in
NPC cells (43). This indicates that during extreme intralysosomal accumulation of cholesterol, GBA
actively generates GlcChol. In normal lysosomes GBA most likely largely degrades the glucosylated
sterol.
Figure 5. GlcChol abnormalities in NPC. A: GlcChol (nanomoles per gram wet weight) in liver of BALB/c
Npc1+/+, Npc1+/nih and Npc1nih/nih male mice at 80 days of age (n = 3, mean ± S.D.) B: GlcChol (nanomoles per
gram wet weight) in liver of C57BLKS Npc1+/spm and Npc1spm/spm male mice at 80 days of age (n = 3-5, mean ±
S.D.). C: GlcChol (picomoles per milligram protein) in RAW264.7 cells incubated with indicated concentration
U18666A for 1 day in absence and presence of CBE inhibiting GBA (n = 3 mean ± S.D.). D: GlcChol
(picomoles per milligram protein) in RAW264.7 cells incubated with 10 µM U18666A for 8 h and in
subsequent absence or presence of 1 mM β-methyl-cyclodextrin (β-mCD) reducing intralysosomal cholesterol
for 18 h (n = 3 mean ± S.D.). Data were analyzed using an unpaired t-test. ** P < 0.01 and *** P < 0.001.
GlcChol in NPC and GD patients
Finally, we determined GlcChol levels in plasma of untreated symptomatic type 1 GD patients as well
as in NPC patients, carriers and healthy controls. As shown in Figure 6A, GlcChol tends to be
increased in plasma of symptomatic GD patients and less prominently in that of NPC patients. The
abnormalities in GD patients are more pronounced when plasma GlcChol is related to cholesterol
(Chol, Figure 6B). Investigation of plasma specimens of type 1 GD patients treated with GCS
inhibitor Eliglustat (Figure 6C), showed a prominent reduction upon inhibition of GSL synthesis.
Treatment of matched patients with the weaker GCS inhibitor Miglustat (Zavesca®, Actelion) also led
to a reduction of GlcChol, albeit slower (Figure 6C). Of note, treatment of matched patients with
rGBA Cerezyme (enzyme replacement therapy; ERT) did not reduce GlcChol to the same extent,
despite impressive clinical improvements in these patients (Figure 6C) (B.E. Smid et al. unpublished).
Figure 6. Plasma GlcChol in LSD patients and healthy individuals. A: Plasma GlcChol (nanomolar) in
healthy individuals, type 1 GD patients, NPC carriers and NPC patients. B: Ratio of GlcChol/cholesterol (Chol)
in plasma of healthy individuals, type 1 GD patients, NPC carriers and NPC patients. C: Percentage reduction in
plasma GlcChol of matched type 1 GD patients following Eliglustat, Miglustat and ERT treatment compared to
pre-treatment values. Data were analyzed using the Mann-Whitney U test. ** P < 0.01 and *** P < 0.001.
Discussion
Recently, Akiyama and colleagues (11) demonstrated that GBA, either pure recombinant protein or
enzyme in fibroblast lysates, can generate GlcChol by transglucosylation of cholesterol when
provided with GlcCer as donor. The physiological significance of glucosylation of cholesterol is
hypothetically great since it renders a molecule far more water soluble. To establish the natural
occurrence of GlcChol in mammals, we first needed to develop a quantitative and sensitive assay for
quantification of GlcChol in plasma, cells and tissues. The method developed by us makes use of
newly synthesized 13C6-GlcChol as internal standard. Regarding extraction efficiency,
chromatographic behavior and ionization characteristics, the natural and isotope labelled compounds
are identical, so no correction for the sample matrix (ion suppression or ion enhancement) is required.
With sensitive quantification of GlcChol in place, we next observed that almost all tissues of
mice show GlcChol. The relative high amount of the glucosylated sterol in the thymus, several
Glucosylated cholesterol metabolism by β-glucosidases 263
nanomoles per gram wet weight, is striking and deserves special attention in view of noted
abnormalities in NKT and B-cells in GBA-deficient GD patients (44). It has been speculated by
Mistry and colleagues that elevated GlcCer or GlcSph via binding to CD1 may be causing this
phenomenon (44). It will be now of interest to study whether GlcChol interacts with CD1 since
abnormalities in concentration of this lipid in GBA-deficient GD patients are likely.
Indeed, we recapitulated the finding that GBA is able to form GlcChol by transglucosylation of
cholesterol, at least in vitro. Artificial β-glucosides like 4MU-Glc may in vitro act as donor in this
reaction as well as natural GlcCer. GlcChol is on the other hand also an excellent substrate for
hydrolysis by GBA. Our findings suggest that GBA normally lowers GlcChol levels. GBA-deficient
LIMP2 KO mice show modestly elevated GlcChol in several tissues and the same is observed in
GBAnull/flox mice with induced type 1 GD (32). Finally, plasma GlcChol is elevated in symptomatic
type 1 GD patients. The actual role played by GBA in GlcChol metabolism, degradation versus
synthesis, might be highly dependent on local concentrations of donors (GlcCer and GlcChol) and
acceptors (ceramide and cholesterol) in the transglucosylation equilibrium of the enzyme. The
importance of this is suggested by some observations made in the course of our investigation. In the
first place, high intralysosomal cholesterol concentrations appear to favor formation of GlcChol by
GBA. This is indicated by the 25-fold elevated GlcChol in liver of two different models of NPC
disease in mice. In accordance with this, induction of lysosomal cholesterol accumulation with
U18666A in cells causes a rapid increase in GlcChol, which was noted to be abolished by inactivation
of GBA. Consequently, under normal conditions, GBA seems to promote GlcChol degradation, but
under excess cholesterol accumulation in lysosomal membrane, such found in NPC, the equilibrium
of the metabolism is altered to favor GlcChol formation by GBA.
We observed that the non-lysosomal β-glucosidase GBA2 can also generate in vitro GlcChol
through transglucosylation. Again, GlcCer was found to be an excellent donor for this reaction. GBA2
is equally able to degrade GlcChol. Our finding of reduced GlcChol levels in GBA2 KO mice
suggests, but does not entirely prove, that GBA2 in vivo contributes to the presence of GlcChol. The
enzyme GBA2 is located differently in cells from lysosomal GBA, with its catalytic pocket exposed
to cytoplasmic leaflet of membranes. It likely encounters different concentrations of GlcCer and
cholesterol than GBA given its location close to the cellular sites of de novo synthesis of these lipids.
To maximally form GlcChol through transglucosylation, high concentrations of GlcCer as donor and
high concentrations of cholesterol as acceptor are optimal. Vice versa, low concentrations of GlcCer
and cholesterol will reduce net GlcChol formation. This consideration holds equally for GBA2 and
GBA. Fluctuations in sterols and sphingolipids conceivably occur in cells, for example after uptake of
cholesterol-rich lipoproteins or upon release of ceramide from sphingomyelin. The ability to maintain
some equilibrium between (glucosylated) sphingolipids and sterols by transglucosylating βglucosidases may have beneficial buffering effects for cells. Of interest in this respect is our finding
that inhibition of GCS leads to reduction of GlcChol in cultured cells, plasma of mice and plasma of
GD patients. This strongly suggests that the availability of GlcCer is an important driver of formation
of GlcChol through transglucosylation. Since the β-glucosidases GBA and GBA2 also hydrolyze
GlcCer, and thus tend to lower its concentration, the exquisite balance of various GlcCer metabolizing
enzymes and local cholesterol concentrations will determine GlcChol formation in subcellular
compartments.
GlcChol is far more water soluble than cholesterol and therefore more suited for transport. The
relatively low steady concentration of GlcChol does not exclude a vital role as intermediate in a
transport pathway. Tentatively, water soluble GlcChol formed by transglucosylation at one cellular
site would be transported and reconverted at the destination site back to more inert cholesterol. The
combination of the two enzymes GBA and GBA2 could provide of such a mechanism, without need
for ATP. Of interest in view of this speculation is that LIMP2, the membrane protein interacting with
GBA, is recently shown to have a cholesterol binding site and potentially even a tunnel/channel
function (45).
A final consideration concerns the possible pathophysiological consequences of disturbed
GlcChol metabolism. It seems likely that in individuals with abnormal GlcCer metabolism, as for
example GBA-deficient GD patients, secondary abnormalities in GlcChol occur. Future research will
need to reveal whether such abnormalities in GlcChol or in other glucosylated metabolites contribute
to particular symptoms associated with GD. In conclusion, GlcCer has earlier been identified as an
important structural membrane component and intermediate in GSL biosynthesis. In addition, it is
known to act as important sink for pro-apoptotic ceramide (46, 47). Our study suggests that GlcCer
may furthermore act as glucosyl-donor in the formation of GlcChol via transglycosylation.
Acknowledgements
We thank colleagues in the Academic Medical Center SPHINX clinic, Bouwien Smid and Carla
Hollak, for sharing Gaucher disease patient materials. The longstanding support by Dutch Gaucher
disease patients is acknowledged.
Sources of funding
The study was made possible by the ERC AdG CHEMBIOSPHIN.
Disclosures
None relevant to this study.
References
1. Wennekes, T., R. J. B. H. N. van den Berg, R. G. Boot, G. a van der Marel, H. S. Overkleeft, and J. M. F. G.
Aerts. 2009. Glycosphingolipids-nature, function, and pharmacological modulation. Angew. Chem. Int.
Ed. Engl. 48: 8848–8869.
2. Pata, M. O., Y. A. Hannun, and C. K.-Y. Ng. 2010. Plant sphingolipids: decoding the enigma of the Sphinx.
New Phytol. 185: 611–630.
3. Wu, W., R. Narasaki, F. Maeda, and K. Hasumi. 2004. Glucosyldiacylglycerol enhances reciprocal activation
of prourokinase and plasminogen. Biosci. Biotechnol. Biochem. 68: 1549–1556.
4. Grille, S., A. Zaslawski, S. Thiele, J. Plat, and D. Warnecke. 2010. The functions of steryl glycosides come to
those who wait: Recent advances in plants, fungi, bacteria and animals. Prog. Lipid Res. 49: 262–288.
5. Kunimoto, S., T. Kobayashi, S. Kobayashi, and K. Murakami-Murofushi. 2000. Expression of cholesteryl
glucoside by heat shock in human fibroblasts. Cell Stress Chaperones. 5: 3–7.
6. Kunimoto, S., W. Murofushi, I. Yamatsu, Y. Hasegawa, N. Sasaki, S. Kobayashi, T. Kobayashi, H.
Murofushi, and K. Murakami-Murofushi. 2003. Cholesteryl Glucoside-induced Protection against
Gastric Ulcer. Cell Struct. Funct. 28: 179–186.
7. Kunimoto, S., W. Murofushi, H. Kai, Y. Ishida, A. Uchiyama, T. Kobayashi, S. Kobayashi, H. Murofushi,
and K. Murakami-Murofushi. 2002. Steryl glucoside is a lipid mediator in stress-responsive signal
transduction. Cell Struct. Funct. 27: 157–162.
8. Ichikawa, S., H. Sakiyama, G. Suzuki, K. I. Hidari, and Y. Hirabayashi. 1996. Expression cloning of a cDNA
for human ceramide glucosyltransferase that catalyzes the first glycosylation step of glycosphingolipid
synthesis. Proc. Natl. Acad. Sci. U. S. A. 93: 12654.
9. van Meer, G., J. Wolthoorn, and S. Degroote. 2003. The fate and function of glycosphingolipid
glucosylceramide. Philos. Trans. R. Soc. Lond. B. Biol. Sci. 358: 869–873.
10. Akiyama, H., N. Sasaki, S. Hanazawa, M. Gotoh, S. Kobayashi, Y. Hirabayashi, and K. MurakamiMurofushi. 2011. Novel sterol glucosyltransferase in the animal tissue and cultured cells: evidence that
glucosylceramide as glucose donor. Biochim. Biophys. Acta. 1811: 314–322.
Chapter 13264
Ch ap te r 1
3
nanomoles per gram wet weight, is striking and deserves special attention in view of noted
abnormalities in NKT and B-cells in GBA-deficient GD patients (44). It has been speculated by
Mistry and colleagues that elevated GlcCer or GlcSph via binding to CD1 may be causing this
phenomenon (44). It will be now of interest to study whether GlcChol interacts with CD1 since
abnormalities in concentration of this lipid in GBA-deficient GD patients are likely.
Indeed, we recapitulated the finding that GBA is able to form GlcChol by transglucosylation of
cholesterol, at least in vitro. Artificial β-glucosides like 4MU-Glc may in vitro act as donor in this
reaction as well as natural GlcCer. GlcChol is on the other hand also an excellent substrate for
hydrolysis by GBA. Our findings suggest that GBA normally lowers GlcChol levels. GBA-deficient
LIMP2 KO mice show modestly elevated GlcChol in several tissues and the same is observed in
GBAnull/flox mice with induced type 1 GD (32). Finally, plasma GlcChol is elevated in symptomatic
type 1 GD patients. The actual role played by GBA in GlcChol metabolism, degradation versus
synthesis, might be highly dependent on local concentrations of donors (GlcCer and GlcChol) and
acceptors (ceramide and cholesterol) in the transglucosylation equilibrium of the enzyme. The
importance of this is suggested by some observations made in the course of our investigation. In the
first place, high intralysosomal cholesterol concentrations appear to favor formation of GlcChol by
GBA. This is indicated by the 25-fold elevated GlcChol in liver of two different models of NPC
disease in mice. In accordance with this, induction of lysosomal cholesterol accumulation with
U18666A in cells causes a rapid increase in GlcChol, which was noted to be abolished by inactivation
of GBA. Consequently, under normal conditions, GBA seems to promote GlcChol degradation, but
under excess cholesterol accumulation in lysosomal membrane, such found in NPC, the equilibrium
of the metabolism is altered to favor GlcChol formation by GBA.
We observed that the non-lysosomal β-glucosidase GBA2 can also generate in vitro GlcChol
through transglucosylation. Again, GlcCer was found to be an excellent donor for this reaction. GBA2
is equally able to degrade GlcChol. Our finding of reduced GlcChol levels in GBA2 KO mice
suggests, but does not entirely prove, that GBA2 in vivo contributes to the presence of GlcChol. The
enzyme GBA2 is located differently in cells from lysosomal GBA, with its catalytic pocket exposed
to cytoplasmic leaflet of membranes. It likely encounters different concentrations of GlcCer and
cholesterol than GBA given its location close to the cellular sites of de novo synthesis of these lipids.
To maximally form GlcChol through transglucosylation, high concentrations of GlcCer as donor and
high concentrations of cholesterol as acceptor are optimal. Vice versa, low concentrations of GlcCer
and cholesterol will reduce net GlcChol formation. This consideration holds equally for GBA2 and
GBA. Fluctuations in sterols and sphingolipids conceivably occur in cells, for example after uptake of
cholesterol-rich lipoproteins or upon release of ceramide from sphingomyelin. The ability to maintain
some equilibrium between (glucosylated) sphingolipids and sterols by transglucosylating βglucosidases may have beneficial buffering effects for cells. Of interest in this respect is our finding
that inhibition of GCS leads to reduction of GlcChol in cultured cells, plasma of mice and plasma of
GD patients. This strongly suggests that the availability of GlcCer is an important driver of formation
of GlcChol through transglucosylation. Since the β-glucosidases GBA and GBA2 also hydrolyze
GlcCer, and thus tend to lower its concentration, the exquisite balance of various GlcCer metabolizing
enzymes and local cholesterol concentrations will determine GlcChol formation in subcellular
compartments.
GlcChol is far more water soluble than cholesterol and therefore more suited for transport. The
relatively low steady concentration of GlcChol does not exclude a vital role as intermediate in a
transport pathway. Tentatively, water soluble GlcChol formed by transglucosylation at one cellular
site would be transported and reconverted at the destination site back to more inert cholesterol. The
combination of the two enzymes GBA and GBA2 could provide of such a mechanism, without need
for ATP. Of interest in view of this speculation is that LIMP2, the membrane protein interacting with
GBA, is recently shown to have a cholesterol binding site and potentially even a tunnel/channel
function (45).
A final consideration concerns the possible pathophysiological consequences of disturbed
GlcChol metabolism. It seems likely that in individuals with abnormal GlcCer metabolism, as for
example GBA-deficient GD patients, secondary abnormalities in GlcChol occur. Future research will
need to reveal whether such abnormalities in GlcChol or in other glucosylated metabolites contribute
to particular symptoms associated with GD. In conclusion, GlcCer has earlier been identified as an
important structural membrane component and intermediate in GSL biosynthesis. In addition, it is
known to act as important sink for pro-apoptotic ceramide (46, 47). Our study suggests that GlcCer
may furthermore act as glucosyl-donor in the formation of GlcChol via transglycosylation.
Acknowledgements
We thank colleagues in the Academic Medical Center SPHINX clinic, Bouwien Smid and Carla
Hollak, for sharing Gaucher disease patient materials. The longstanding support by Dutch Gaucher
disease patients is acknowledged.
Sources of funding
The study was made possible by the ERC AdG CHEMBIOSPHIN.
Disclosures
None relevant to this study.
References
1. Wennekes, T., R. J. B. H. N. van den Berg, R. G. Boot, G. a van der Marel, H. S. Overkleeft, and J. M. F. G.
Aerts. 2009. Glycosphingolipids-nature, function, and pharmacological modulation. Angew. Chem. Int.
Ed. Engl. 48: 8848–8869.
2. Pata, M. O., Y. A. Hannun, and C. K.-Y. Ng. 2010. Plant sphingolipids: decoding the enigma of the Sphinx.
New Phytol. 185: 611–630.
3. Wu, W., R. Narasaki, F. Maeda, and K. Hasumi. 2004. Glucosyldiacylglycerol enhances reciprocal activation
of prourokinase and plasminogen. Biosci. Biotechnol. Biochem. 68: 1549–1556.
4. Grille, S., A. Zaslawski, S. Thiele, J. Plat, and D. Warnecke. 2010. The functions of steryl glycosides come to
those who wait: Recent advances in plants, fungi, bacteria and animals. Prog. Lipid Res. 49: 262–288.
5. Kunimoto, S., T. Kobayashi, S. Kobayashi, and K. Murakami-Murofushi. 2000. Expression of cholesteryl
glucoside by heat shock in human fibroblasts. Cell Stress Chaperones. 5: 3–7.
6. Kunimoto, S., W. Murofushi, I. Yamatsu, Y. Hasegawa, N. Sasaki, S. Kobayashi, T. Kobayashi, H.
Murofushi, and K. Murakami-Murofushi. 2003. Cholesteryl Glucoside-induced Protection against
Gastric Ulcer. Cell Struct. Funct. 28: 179–186.
7. Kunimoto, S., W. Murofushi, H. Kai, Y. Ishida, A. Uchiyama, T. Kobayashi, S. Kobayashi, H. Murofushi,
and K. Murakami-Murofushi. 2002. Steryl glucoside is a lipid mediator in stress-responsive signal
transduction. Cell Struct. Funct. 27: 157–162.
8. Ichikawa, S., H. Sakiyama, G. Suzuki, K. I. Hidari, and Y. Hirabayashi. 1996. Expression cloning of a cDNA
for human ceramide glucosyltransferase that catalyzes the first glycosylation step of glycosphingolipid
synthesis. Proc. Natl. Acad. Sci. U. S. A. 93: 12654.
9. van Meer, G., J. Wolthoorn, and S. Degroote. 2003. The fate and function of glycosphingolipid
glucosylceramide. Philos. Trans. R. Soc. Lond. B. Biol. Sci. 358: 869–873.
10. Akiyama, H., N. Sasaki, S. Hanazawa, M. Gotoh, S. Kobayashi, Y. Hirabayashi, and K. MurakamiMurofushi. 2011. Novel sterol glucosyltransferase in the animal tissue and cultured cells: evidence that
glucosylceramide as glucose donor. Biochim. Biophys. Acta. 1811: 314–322.
Glucosylated cholesterol metabolism by β-glucosidases 265
11. Akiyama, H., S. Kobayashi, Y. Hirabayashi, and K. Murakami-Murofushi. 2013. Cholesterol glucosylation
is catalyzed by transglucosylation reaction of β-glucosidase 1. Biochem. Biophys. Res. Commun. 441:
838–843.
12. Vanderjagt, D. J., D. E. Fry, and R. H. Glew. 1994. Human glucocerebrosidase catalyses transglucosylation
between glucocerebroside and retinol. Biochem. J. 300: 309–315.
13. Beutler, E., and G. A. Grabowski. 1995. Gaucher disease. In The Metabolic and Molecular Bases of
Inherited Disease (Scriver, C. R., Beadet, A. L., Sly, W. S., and Valle, D., eds.). 7th Ed., pp. 2641–2670.
, McGraw-Hill, New York, NY.
14. Ferraz, M. J., W. W. Kallemeijn, M. Mirzaian, D. Herrera Moro, A. Marques, P. Wisse, R. G. Boot, L. I.
Willems, H. S. Overkleeft, and J. M. Aerts. 2014. Gaucher disease and Fabry disease: new markers and
insights in pathophysiology for two distinct glycosphingolipidoses. Biochim. Biophys. Acta. 1841: 811–
825.
15. Dekker, N., L. van Dussen, C. E. M. Hollak, H. Overkleeft, S. Scheij, K. Ghauharali, M. J. van Breemen, M.
J. Ferraz, J. E. M. Groener, M. Maas, F. A. Wijburg, D. Speijer, A. Tylki-Szymanska, P. K. Mistry, R.
G. Boot, and J. M. Aerts. 2011. Elevated plasma glucosylsphingosine in Gaucher disease: relation to
phenotype, storage cell markers, and therapeutic response. Blood. 118: e118–127.
16. Rolfs, A., A.-K. Giese, U. Grittner, D. Mascher, D. Elstein, A. Zimran, T. Böttcher, J. Lukas, R. Hübner, U.
Gölnitz, A. Röhle, A. Dudesek, W. Meyer, M. Wittstock, and H. Mascher. 2013. Glucosylsphingosine is
a highly sensitive and specific biomarker for primary diagnostic and follow-up monitoring in Gaucher
disease in a non-Jewish, Caucasian cohort of Gaucher disease patients. PLoS One. 8: e79732.
17. Barton, N. W., R. O. Brady, J. M. Dambrosia, A. M. Di Bisceglie, S. H. Doppelt, S. C. Hill, H. J. Mankin,
G. J. Murray, R. I. Parker, and C. E. Argoff. 1991. Replacement therapy for inherited enzyme
deficiency--macrophage-targeted glucocerebrosidase for Gaucher’s disease. N. Engl. J. Med. 324: 1464–
1470.
18. Cox, T., R. Lachmann, C. Hollak, J. Aerts, S. van Weely, M. Hrebícek, F. Platt, T. Butters, R. Dwek, C.
Moyses, I. Gow, D. Elstein, and A. Zimran. 2000. Novel oral treatment of Gaucher’s disease with Nbutyldeoxynojirimycin (OGT 918) to decrease substrate biosynthesis. Lancet. 355: 1481–1485.
19. Cox, T. M., G. Drelichman, R. Cravo, M. Balwani, T. A. Burrow, A. M. Martins, E. Lukina, B.
Rosenbloom, L. Ross, J. Angell, and A. C. Puga. 2015. Eliglustat compared with imiglucerase in
patients with Gaucher’s disease type 1 stabilised on enzyme replacement therapy: a phase 3,
randomised, open-label, non-inferiority trial. Lancet. 385: 2355–2362.
20. Hughes, D. A., and G. M. Pastores. 2015. Eliglustat for Gaucher’s disease: trippingly on the tongue. Lancet.
385: 2328–2330.
21. van Weely, S., M. Brandsma, A. Strijland, J. M. Tager, and J. M. Aerts. 1993. Demonstration of the
existence of a second, non-lysosomal glucocerebrosidase that is not deficient in Gaucher disease.
Biochim. Biophys. Acta. 1181: 55–62.
22. Yildiz, Y., H. Matern, B. Thompson, J. C. Allegood, R. L. Warren, D. M. O. Ramirez, R. E. Hammer, F. K.
Hamra, S. Matern, and D. W. Russell. 2006. Mutation of beta-glucosidase 2 causes glycolipid storage
disease and impaired male fertility. J. Clin. Invest. 116: 2985–2994.
23. Boot, R. G., M. Verhoek, W. Donker-Koopman, A. Strijland, J. van Marle, H. S. Overkleeft, T. Wennekes,
and J. M. F. G. Aerts. 2007. Identification of the non-lysosomal glucosylceramidase as beta-glucosidase
2. J. Biol. Chem. 282: 1305–1312.
24. Burke, D. G., A. A. Rahim, S. N. Waddington, S. Karlsson, I. Enquist, K. Bhatia, A. Mehta, A. Vellodi, and
S. Heales. 2013. Increased glucocerebrosidase (GBA) 2 activity in GBA1 deficient mice brains and in
Gaucher leucocytes. J. Inherit. Metab. Dis. 36: 869–872.
25. Koerschen, H. G., Y. Yildiz, D. N. Raju, S. Schonauer, W. Boenigk, V. Jansen, E. Kremmer, U. B. Kaupp,
and D. Wachten. 2012. The non-lysosomal beta-glucosidase GBA2 is a non-integral membraneassociated protein at the ER and Golgi. J. Biol. Chem. 288: 3381–3393.
26. Dekker, N., T. Voorn-Brouwer, M. Verhoek, T. Wennekes, R. S. Narayan, D. Speijer, C. E. M. Hollak, H. S.
Overkleeft, R. G. Boot, and J. M. F. G. Aerts. 2011. The cytosolic β-glucosidase GBA3 does not
influence type 1 Gaucher disease manifestation. Blood Cells. Mol. Dis. 46: 19–26.
27. Kittl, R., and S. G. Withers. 2010. New approaches to enzymatic glycoside synthesis through directed
evolution. Carbohydr. Res. 345: 1272–1279.
28. Deng, S., B. Yu, Y. Lou, and Y. Hui. 1999. First Total Synthesis of an Exceptionally Potent Antitumor
Saponin, OSW-1. J. Org. Chem. 64: 202–208.
29. Loftus, S. K., J. A. Morris, E. D. Carstea, J. Z. Gu, C. Cummings, A. Brown, J. Ellison, K. Ohno, M. A.
Rosenfeld, D. A. Tagle, P. G. Pentchev, and W. J. Pavan. 1997. Murine model of Niemann-Pick C
disease: mutation in a cholesterol homeostasis gene. Science. 277: 232–235.
30. Miyawaki S, Yoshida H, Mitsuoka S, Enomoto H, I. S., S. Miyawaki, H. Yoshida, S. Mitsuoka, H.
Enomoto, and S. Ikehara. 1986. A mouse model for Niemann-Pick disease. Influence of genetic
background on disease expression in spm/spm mice. J. Hered. 77: 379–384.
31. Gamp, A.-C., Y. Tanaka, R. Lüllmann-Rauch, D. Wittke, R. D’Hooge, P. P. De Deyn, T. Moser, H. Maier,
D. Hartmann, K. Reiss, A.-L. Illert, K. von Figura, and P. Saftig. 2003. LIMP-2/LGP85 deficiency
causes ureteric pelvic junction obstruction, deafness and peripheral neuropathy in mice. Hum. Mol.
Genet. 12: 631–646.
32. Dahl, M., A. Doyle, K. Olsson, J.-E. Månsson, A. R. A. Marques, M. Mirzaian, J. M. Aerts, M. Ehinger, M.
Rothe, U. Modlich, A. Schambach, and S. Karlsson. 2015. Lentiviral gene therapy using cellular
promoters cures type 1 Gaucher disease in mice. Mol. Ther. 23: 835–844.
33. Enquist, I. B., E. Nilsson, A. Ooka, J.-E. Månsson, K. Olsson, M. Ehinger, R. O. Brady, J. Richter, and S.
Karlsson. 2006. Effective cell and gene therapy in a murine model of Gaucher disease. Proc. Natl. Acad.
Sci. U. S. A. 103: 13819–24.
34. Bligh, E. G., and W. J. Dyer. 1959. A rapid method of total lipid extraction and purification. Can J Biochem
Physiol. 37: 911–7.
35. Van Weely, S., M. B. Van Leeuwen, I. D. Jansen, M. A. De Bruijn, E. M. Brouwer-Kelder, a W. Schram,
M. C. Sa Miranda, J. A. Barranger, E. M. Petersen, and J. Goldblatt. 1991. Clinical phenotype of
Gaucher disease in relation to properties of mutant glucocerebrosidase in cultured fibroblasts. Biochim.
Biophys. Acta. 1096: 301–311.
36. Groener, J. E. M., B. J. H. M. Poorthuis, S. Kuiper, M. T. J. Helmond, C. E. M. Hollak, and J. M. F. G.
Aerts. 2007. HPLC for simultaneous quantification of total ceramide, glucosylceramide, and ceramide
trihexoside concentrations in plasma. Clin. Chem. 53: 742–747.
37. Pavlova, E., S. Wang, J. Archer, N. Dekker, J. Aerts, S. Karlsson, and T. Cox. 2013. B cell lymphoma and
myeloma in murine Gaucher’s disease. J. Pathol. 231: 88–97.
38. Overkleeft, H. S., G. H. Renkema, J. Neele, P. Vianello, I. O. Hung, A. Strijland, A. M. van der Burg, G. J.
Koomen, U. K. Pandit, and J. M. Aerts. 1998. Generation of specific deoxynojirimycin-type inhibitors
of the non-lysosomal glucosylceramidase. J. Biol. Chem. 273: 26522–265227.
39. Morris, M. D., C. Bhuvaneswaran, H. Shio, and S. Fowler. 1982. Lysosome lipid storage disorder in NCTRBALB/c mice. I. Description of the disease and genetics. Am. J. Pathol. 108: 140–149.
40. Pentchev, P. G., A. D. Boothe, H. S. Kruth, H. Weintroub, J. Stivers, and R. O. Brady. 1984. A genetic
storage disorder in BALB/C mice with a metabolic block in esterification of exogenous cholesterol. J.
Biol. Chem. 259: 5784–5791.
41. Miyawaki, S., S. Mitsuoka, T. Sakiyama, and T. Kitagawa. 1982. Sphingomyelinosis, a new mutation in the
mouse: a model of Niemann-Pick disease in humans. J. Hered. 73: 257–263.
42. Liscum, L., and J. R. Faust. 1989. The intracellular transport of low density lipoprotein-derived cholesterol
is inhibited in Chinese hamster ovary cells cultured with 3-beta-[2-(diethylamino)ethoxy]androst-5-en17-one. J. Biol. Chem. 264: 11796–11806.
43. Vance, J. E., and B. Karten. 2014. Niemann-Pick C disease and mobilization of lysosomal cholesterol by
cyclodextrin. J. Lipid Res. 55: 1609–1621.
44. Nair, S., C. S. Boddupalli, R. Verma, J. Liu, R. Yang, G. M. Pastores, P. K. Mistry, and M. V Dhodapkar.
2015. Type II NKT-TFH cells against Gaucher lipids regulate B-cell immunity and inflammation.
Blood. 125: 1256–1271.
45. Neculai, D., M. Schwake, M. Ravichandran, F. Zunke, R. F. Collins, J. Peters, M. Neculai, J. Plumb, P.
Loppnau, J. C. Pizarro, A. Seitova, W. S. Trimble, P. Saftig, S. Grinstein, and S. Dhe-Paganon. 2013.
Structure of LIMP-2 provides functional insights with implications for SR-BI and CD36. Nature. 504:
172–176.
Chapter 13266
Ch ap te r 1
3
11. Akiyama, H., S. Kobayashi, Y. Hirabayashi, and K. Murakami-Murofushi. 2013. Cholesterol glucosylation
is catalyzed by transglucosylation reaction of β-glucosidase 1. Biochem. Biophys. Res. Commun. 441:
838–843.
12. Vanderjagt, D. J., D. E. Fry, and R. H. Glew. 1994. Human glucocerebrosidase catalyses transglucosylation
between glucocerebroside and retinol. Biochem. J. 300: 309–315.
13. Beutler, E., and G. A. Grabowski. 1995. Gaucher disease. In The Metabolic and Molecular Bases of
Inherited Disease (Scriver, C. R., Beadet, A. L., Sly, W. S., and Valle, D., eds.). 7th Ed., pp. 2641–2670.
, McGraw-Hill, New York, NY.
14. Ferraz, M. J., W. W. Kallemeijn, M. Mirzaian, D. Herrera Moro, A. Marques, P. Wisse, R. G. Boot, L. I.
Willems, H. S. Overkleeft, and J. M. Aerts. 2014. Gaucher disease and Fabry disease: new markers and
insights in pathophysiology for two distinct glycosphingolipidoses. Biochim. Biophys. Acta. 1841: 811–
825.
15. Dekker, N., L. van Dussen, C. E. M. Hollak, H. Overkleeft, S. Scheij, K. Ghauharali, M. J. van Breemen, M.
J. Ferraz, J. E. M. Groener, M. Maas, F. A. Wijburg, D. Speijer, A. Tylki-Szymanska, P. K. Mistry, R.
G. Boot, and J. M. Aerts. 2011. Elevated plasma glucosylsphingosine in Gaucher disease: relation to
phenotype, storage cell markers, and therapeutic response. Blood. 118: e118–127.
16. Rolfs, A., A.-K. Giese, U. Grittner, D. Mascher, D. Elstein, A. Zimran, T. Böttcher, J. Lukas, R. Hübner, U.
Gölnitz, A. Röhle, A. Dudesek, W. Meyer, M. Wittstock, and H. Mascher. 2013. Glucosylsphingosine is
a highly sensitive and specific biomarker for primary diagnostic and follow-up monitoring in Gaucher
disease in a non-Jewish, Caucasian cohort of Gaucher disease patients. PLoS One. 8: e79732.
17. Barton, N. W., R. O. Brady, J. M. Dambrosia, A. M. Di Bisceglie, S. H. Doppelt, S. C. Hill, H. J. Mankin,
G. J. Murray, R. I. Parker, and C. E. Argoff. 1991. Replacement therapy for inherited enzyme
deficiency--macrophage-targeted glucocerebrosidase for Gaucher’s disease. N. Engl. J. Med. 324: 1464–
1470.
18. Cox, T., R. Lachmann, C. Hollak, J. Aerts, S. van Weely, M. Hrebícek, F. Platt, T. Butters, R. Dwek, C.
Moyses, I. Gow, D. Elstein, and A. Zimran. 2000. Novel oral treatment of Gaucher’s disease with Nbutyldeoxynojirimycin (OGT 918) to decrease substrate biosynthesis. Lancet. 355: 1481–1485.
19. Cox, T. M., G. Drelichman, R. Cravo, M. Balwani, T. A. Burrow, A. M. Martins, E. Lukina, B.
Rosenbloom, L. Ross, J. Angell, and A. C. Puga. 2015. Eliglustat compared with imiglucerase in
patients with Gaucher’s disease type 1 stabilised on enzyme replacement therapy: a phase 3,
randomised, open-label, non-inferiority trial. Lancet. 385: 2355–2362.
20. Hughes, D. A., and G. M. Pastores. 2015. Eliglustat for Gaucher’s disease: trippingly on the tongue. Lancet.
385: 2328–2330.
21. van Weely, S., M. Brandsma, A. Strijland, J. M. Tager, and J. M. Aerts. 1993. Demonstration of the
existence of a second, non-lysosomal glucocerebrosidase that is not deficient in Gaucher disease.
Biochim. Biophys. Acta. 1181: 55–62.
22. Yildiz, Y., H. Matern, B. Thompson, J. C. Allegood, R. L. Warren, D. M. O. Ramirez, R. E. Hammer, F. K.
Hamra, S. Matern, and D. W. Russell. 2006. Mutation of beta-glucosidase 2 causes glycolipid storage
disease and impaired male fertility. J. Clin. Invest. 116: 2985–2994.
23. Boot, R. G., M. Verhoek, W. Donker-Koopman, A. Strijland, J. van Marle, H. S. Overkleeft, T. Wennekes,
and J. M. F. G. Aerts. 2007. Identification of the non-lysosomal glucosylceramidase as beta-glucosidase
2. J. Biol. Chem. 282: 1305–1312.
24. Burke, D. G., A. A. Rahim, S. N. Waddington, S. Karlsson, I. Enquist, K. Bhatia, A. Mehta, A. Vellodi, and
S. Heales. 2013. Increased glucocerebrosidase (GBA) 2 activity in GBA1 deficient mice brains and in
Gaucher leucocytes. J. Inherit. Metab. Dis. 36: 869–872.
25. Koerschen, H. G., Y. Yildiz, D. N. Raju, S. Schonauer, W. Boenigk, V. Jansen, E. Kremmer, U. B. Kaupp,
and D. Wachten. 2012. The non-lysosomal beta-glucosidase GBA2 is a non-integral membraneassociated protein at the ER and Golgi. J. Biol. Chem. 288: 3381–3393.
26. Dekker, N., T. Voorn-Brouwer, M. Verhoek, T. Wennekes, R. S. Narayan, D. Speijer, C. E. M. Hollak, H. S.
Overkleeft, R. G. Boot, and J. M. F. G. Aerts. 2011. The cytosolic β-glucosidase GBA3 does not
influence type 1 Gaucher disease manifestation. Blood Cells. Mol. Dis. 46: 19–26.
27. Kittl, R., and S. G. Withers. 2010. New approaches to enzymatic glycoside synthesis through directed
evolution. Carbohydr. Res. 345: 1272–1279.
28. Deng, S., B. Yu, Y. Lou, and Y. Hui. 1999. First Total Synthesis of an Exceptionally Potent Antitumor
Saponin, OSW-1. J. Org. Chem. 64: 202–208.
29. Loftus, S. K., J. A. Morris, E. D. Carstea, J. Z. Gu, C. Cummings, A. Brown, J. Ellison, K. Ohno, M. A.
Rosenfeld, D. A. Tagle, P. G. Pentchev, and W. J. Pavan. 1997. Murine model of Niemann-Pick C
disease: mutation in a cholesterol homeostasis gene. Science. 277: 232–235.
30. Miyawaki S, Yoshida H, Mitsuoka S, Enomoto H, I. S., S. Miyawaki, H. Yoshida, S. Mitsuoka, H.
Enomoto, and S. Ikehara. 1986. A mouse model for Niemann-Pick disease. Influence of genetic
background on disease expression in spm/spm mice. J. Hered. 77: 379–384.
31. Gamp, A.-C., Y. Tanaka, R. Lüllmann-Rauch, D. Wittke, R. D’Hooge, P. P. De Deyn, T. Moser, H. Maier,
D. Hartmann, K. Reiss, A.-L. Illert, K. von Figura, and P. Saftig. 2003. LIMP-2/LGP85 deficiency
causes ureteric pelvic junction obstruction, deafness and peripheral neuropathy in mice. Hum. Mol.
Genet. 12: 631–646.
32. Dahl, M., A. Doyle, K. Olsson, J.-E. Månsson, A. R. A. Marques, M. Mirzaian, J. M. Aerts, M. Ehinger, M.
Rothe, U. Modlich, A. Schambach, and S. Karlsson. 2015. Lentiviral gene therapy using cellular
promoters cures type 1 Gaucher disease in mice. Mol. Ther. 23: 835–844.
33. Enquist, I. B., E. Nilsson, A. Ooka, J.-E. Månsson, K. Olsson, M. Ehinger, R. O. Brady, J. Richter, and S.
Karlsson. 2006. Effective cell and gene therapy in a murine model of Gaucher disease. Proc. Natl. Acad.
Sci. U. S. A. 103: 13819–24.
34. Bligh, E. G., and W. J. Dyer. 1959. A rapid method of total lipid extraction and purification. Can J Biochem
Physiol. 37: 911–7.
35. Van Weely, S., M. B. Van Leeuwen, I. D. Jansen, M. A. De Bruijn, E. M. Brouwer-Kelder, a W. Schram,
M. C. Sa Miranda, J. A. Barranger, E. M. Petersen, and J. Goldblatt. 1991. Clinical phenotype of
Gaucher disease in relation to properties of mutant glucocerebrosidase in cultured fibroblasts. Biochim.
Biophys. Acta. 1096: 301–311.
36. Groener, J. E. M., B. J. H. M. Poorthuis, S. Kuiper, M. T. J. Helmond, C. E. M. Hollak, and J. M. F. G.
Aerts. 2007. HPLC for simultaneous quantification of total ceramide, glucosylceramide, and ceramide
trihexoside concentrations in plasma. Clin. Chem. 53: 742–747.
37. Pavlova, E., S. Wang, J. Archer, N. Dekker, J. Aerts, S. Karlsson, and T. Cox. 2013. B cell lymphoma and
myeloma in murine Gaucher’s disease. J. Pathol. 231: 88–97.
38. Overkleeft, H. S., G. H. Renkema, J. Neele, P. Vianello, I. O. Hung, A. Strijland, A. M. van der Burg, G. J.
Koomen, U. K. Pandit, and J. M. Aerts. 1998. Generation of specific deoxynojirimycin-type inhibitors
of the non-lysosomal glucosylceramidase. J. Biol. Chem. 273: 26522–265227.
39. Morris, M. D., C. Bhuvaneswaran, H. Shio, and S. Fowler. 1982. Lysosome lipid storage disorder in NCTRBALB/c mice. I. Description of the disease and genetics. Am. J. Pathol. 108: 140–149.
40. Pentchev, P. G., A. D. Boothe, H. S. Kruth, H. Weintroub, J. Stivers, and R. O. Brady. 1984. A genetic
storage disorder in BALB/C mice with a metabolic block in esterification of exogenous cholesterol. J.
Biol. Chem. 259: 5784–5791.
41. Miyawaki, S., S. Mitsuoka, T. Sakiyama, and T. Kitagawa. 1982. Sphingomyelinosis, a new mutation in the
mouse: a model of Niemann-Pick disease in humans. J. Hered. 73: 257–263.
42. Liscum, L., and J. R. Faust. 1989. The intracellular transport of low density lipoprotein-derived cholesterol
is inhibited in Chinese hamster ovary cells cultured with 3-beta-[2-(diethylamino)ethoxy]androst-5-en17-one. J. Biol. Chem. 264: 11796–11806.
43. Vance, J. E., and B. Karten. 2014. Niemann-Pick C disease and mobilization of lysosomal cholesterol by
cyclodextrin. J. Lipid Res. 55: 1609–1621.
44. Nair, S., C. S. Boddupalli, R. Verma, J. Liu, R. Yang, G. M. Pastores, P. K. Mistry, and M. V Dhodapkar.
2015. Type II NKT-TFH cells against Gaucher lipids regulate B-cell immunity and inflammation.
Blood. 125: 1256–1271.
45. Neculai, D., M. Schwake, M. Ravichandran, F. Zunke, R. F. Collins, J. Peters, M. Neculai, J. Plumb, P.
Loppnau, J. C. Pizarro, A. Seitova, W. S. Trimble, P. Saftig, S. Grinstein, and S. Dhe-Paganon. 2013.
Structure of LIMP-2 provides functional insights with implications for SR-BI and CD36. Nature. 504:
172–176.
Glucosylated cholesterol metabolism by β-glucosidases 267
46. Bleicher, R. J., and M. C. Cabot. 2002. Glucosylceramide synthase and apoptosis. Biochim. Biophys. Acta.
1585: 172–178.
47. Morad, S. A. F., S.-F. Tan, D. J. Feith, M. Kester, D. F. Claxton, T. P. Loughran, B. M. Barth, T. E. Fox,
and M. C. Cabot. 2015. Modification of sphingolipid metabolism by tamoxifen and Ndesmethyltamoxifen in acute myelogenous leukemia-Impact on enzyme activity and response to
cytotoxics. Biochim. Biophys. Acta. 1851: 919–928.
Supplemental Information
Supplemental Methods
Reagents C18-GlcSph (D-glucosyl-β1-1′-D-erythro-sphingosine), C18-GalCer (D-galactosyl-β1-1′
N-palmitoyl-D-erythro-sphingosine) and GalSph (D-galactocosyl-β1-1′-D-erythro-sphingosine) were
obtained from Avanti Polar Lipids (Alabaster, USA).
Molecular Modeling The ligand GlcChol was build and regularized with ligand (1) and
superimposed on the bicyclic nojirimycin analogue ligand that was crystallized in complex with GBA
(pdb code 2XWE) (2) using the program coot (3). Supplementary Figure 4 shows the resulting model
of GBA complexed with GlcChol.
Supplemental References
1. Lebedev, A. A., P. Young, M. N. Isupov, O. V Moroz, A. A. Vagin, and G. N. Murshudov. 2012.
JLigand: a graphical tool for the CCP4 template-restraint library. Acta Crystallogr. D. Biol.
Crystallogr. 68: 431–40.
2. Brumshtein, B., M. Aguilar-Moncayo, J. M. Benito, J. M. García Fernandez, I. Silman, Y.
Shaaltiel, D. Aviezer, J. L. Sussman, A. H. Futerman, and C. Ortiz Mellet. 2011. Cyclodextrinmediated crystallization of acid β-glucosidase in complex with amphiphilic bicyclic
nojirimycin analogues. Org. Biomol. Chem. 9: 4160–7.
3. McNicholas, S., E. Potterton, K. S. Wilson, and M. E. M. Noble. 2011. Presenting your structures:
the CCP4mg molecular-graphics software. Acta Crystallogr. D. Biol. Crystallogr. 67: 386–94.
Supplemental Results
Supplemental Table 1. Degradation of GlcChol by GBA and GBA2.
Input: nmol 4MU-β-Glc hydrolysis per mL/min Percentage GlcChol digestion (200 pmole)
rGBA 1000 99 %
GBA2 0.04 77 %
Chapter 13268
Ch ap te r 1
3
46. Bleicher, R. J., and M. C. Cabot. 2002. Glucosylceramide synthase and apoptosis. Biochim. Biophys. Acta.
1585: 172–178.
47. Morad, S. A. F., S.-F. Tan, D. J. Feith, M. Kester, D. F. Claxton, T. P. Loughran, B. M. Barth, T. E. Fox,
and M. C. Cabot. 2015. Modification of sphingolipid metabolism by tamoxifen and Ndesmethyltamoxifen in acute myelogenous leukemia-Impact on enzyme activity and response to
cytotoxics. Biochim. Biophys. Acta. 1851: 919–928.
Supplemental Information
Supplemental Methods
Reagents C18-GlcSph (D-glucosyl-β1-1′-D-erythro-sphingosine), C18-GalCer (D-galactosyl-β1-1′
N-palmitoyl-D-erythro-sphingosine) and GalSph (D-galactocosyl-β1-1′-D-erythro-sphingosine) were
obtained from Avanti Polar Lipids (Alabaster, USA).
Molecular Modeling The ligand GlcChol was build and regularized with ligand (1) and
superimposed on the bicyclic nojirimycin analogue ligand that was crystallized in complex with GBA
(pdb code 2XWE) (2) using the program coot (3). Supplementary Figure 4 shows the resulting model
of GBA complexed with GlcChol.
Supplemental References
1. Lebedev, A. A., P. Young, M. N. Isupov, O. V Moroz, A. A. Vagin, and G. N. Murshudov. 2012.
JLigand: a graphical tool for the CCP4 template-restraint library. Acta Crystallogr. D. Biol.
Crystallogr. 68: 431–40.
2. Brumshtein, B., M. Aguilar-Moncayo, J. M. Benito, J. M. García Fernandez, I. Silman, Y.
Shaaltiel, D. Aviezer, J. L. Sussman, A. H. Futerman, and C. Ortiz Mellet. 2011. Cyclodextrinmediated crystallization of acid β-glucosidase in complex with amphiphilic bicyclic
nojirimycin analogues. Org. Biomol. Chem. 9: 4160–7.
3. McNicholas, S., E. Potterton, K. S. Wilson, and M. E. M. Noble. 2011. Presenting your structures:
the CCP4mg molecular-graphics software. Acta Crystallogr. D. Biol. Crystallogr. 67: 386–94.
Supplemental Results
Supplemental Table 1. Degradation of GlcChol by GBA and GBA2.
Input: nmol 4MU-β-Glc hydrolysis per mL/min Percentage GlcChol digestion (200 pmole)
rGBA 1000 99 %
GBA2 0.04 77 %
Glucosylated cholesterol metabolism by β-glucosidases 269
Supplemental Figure 1. Increased GlcChol in spleen and bone marrow of mice with induced type 1 GD.
A. Spleen and B. bone marrow GlcChol in wt mice, type 1 GD induced mice untreated, type 1 GD treated with
lentiviral GBA cDNA gene therapy with macrophage specific promotor (CD68), ubiquitously expressed human
phosphoglycerate kinase (PGK) promotor or gammaretroviral vector with the viral promoter spleen focus
forming virus (SFFV) promotor. Data were analyzed using an unpaired t-test. * P < 0.05, ** P < 0.01 and *** P
< 0.001.
Supplemental Figure 2. In vitro formation of GlcChol by different β-glucosidases.
Recombinant rGBA and lysates of cells with overexpression of GBA2, GBA3 or GCS were incubated for 0 and
1 h with cholesterol in the presence of C18:1-GlcCer as donor. Formation of GlcChol (nmol/L*h) was detected
by LC-MS. Inhibition of GlcChol formation by the respective β-glucosidase inhibitors – CBE (GBA), AMPDNM (GBA2) and anDIX (GBA3) – is shown.
Supplemental Figure 3. In vitro formation of GlcChol: pH dependence and donor preference.
A. rGBA (in McIlvaine buffer 0.15 M, 0.2% taurocholate and 0.1% Triton X-100) and lysates of cells
overexpressing GBA2 (in McIlvaine buffer 0.15 M) were incubated for 1 h with 25-NBD-cholesterol in the
presence of C18:1-GlcCer as donor at different pHs. B. rGBA (in McIlvaine buffer 0.15M pH 5.2, 0.2%
taurocholate and 0.1% Triton X-100) and lysates of cells overexpressing GBA2 (in McIlvaine buffer 0.15 M pH
5.8) were incubated for 1 h with 25-NBD-cholesterol in the presence of different donors (100 μM): 4-MUglucopyranoside, C18:1-GlcCer, C18-GlcSph, C18-GalCer and C18-GalSph.
Chapter 13270
Ch ap te r 1
3
Supplemental Figure 1. Increased GlcChol in spleen and bone marrow of mice with induced type 1 GD.
A. Spleen and B. bone marrow GlcChol in wt mice, type 1 GD induced mice untreated, type 1 GD treated with
lentiviral GBA cDNA gene therapy with macrophage specific promotor (CD68), ubiquitously expressed human
phosphoglycerate kinase (PGK) promotor or gammaretroviral vector with the viral promoter spleen focus
forming virus (SFFV) promotor. Data were analyzed using an unpaired t-test. * P < 0.05, ** P < 0.01 and *** P
< 0.001.
Supplemental Figure 2. In vitro formation of GlcChol by different β-glucosidases.
Recombinant rGBA and lysates of cells with overexpression of GBA2, GBA3 or GCS were incubated for 0 and
1 h with cholesterol in the presence of C18:1-GlcCer as donor. Formation of GlcChol (nmol/L*h) was detected
by LC-MS. Inhibition of GlcChol formation by the respective β-glucosidase inhibitors – CBE (GBA), AMPDNM (GBA2) and anDIX (GBA3) – is shown.
Supplemental Figure 3. In vitro formation of GlcChol: pH dependence and donor preference.
A. rGBA (in McIlvaine buffer 0.15 M, 0.2% taurocholate and 0.1% Triton X-100) and lysates of cells
overexpressing GBA2 (in McIlvaine buffer 0.15 M) were incubated for 1 h with 25-NBD-cholesterol in the
presence of C18:1-GlcCer as donor at different pHs. B. rGBA (in McIlvaine buffer 0.15M pH 5.2, 0.2%
taurocholate and 0.1% Triton X-100) and lysates of cells overexpressing GBA2 (in McIlvaine buffer 0.15 M pH
5.8) were incubated for 1 h with 25-NBD-cholesterol in the presence of different donors (100 μM): 4-MUglucopyranoside, C18:1-GlcCer, C18-GlcSph, C18-GalCer and C18-GalSph.
Glucosylated cholesterol metabolism by β-glucosidases 271
Supplemental Figure 4. Molecular docking of GlcChol in GBA crystal structure 2XWE.
GlcChol docked on GBA crystal structure 2XWE. GlcChol is shown in green with its oxygen atoms in red.
GBA is shown in blue (and gold) with the catalytic residues Glu235 and Glu340 labeled. Side chains that are
within 5 Å of GlcChol are also displayed.
Chapter 13272

PDF Document reader online

This website is focused on providing document in readable format, online without need to install any type of software on your computer. If you are using thin client, or are not allowed to install document reader of particular type, this application may come in hand for you. Simply upload your document, and Docureader.top will transform it into readable format in a few seconds. Why choose Docureader.top?

  1. Unlimited sharing - you can upload document of any size. If we are able to convert it into readable format, you have it here - saved for later or immediate reading
  2. Cross-platform - no compromised when reading your document. We support most of modern browers without the need of installing any of external plugins. If your device can oper a browser - then you can read any document on it
  3. Simple uploading - no need to register. Just enter your email, title of document and select the file, we do the rest. Once the document is ready for you, you will receive automatic email from us.

Previous 10

Next 10